SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g01920): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g01920): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g01920

Feature Type:gene_model
Chromosome:Gm01
Start:1504881
stop:1510358
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g01920
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G32230AT Annotation by Michelle Graham. TAIR10: WWE protein-protein interaction domain protein family | chr1:11613427-11615748 FORWARD LENGTH=570 SoyBaseE_val: 2.00E-63ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0000303GO-bp Annotation by Michelle Graham. GO Biological Process: response to superoxide SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006809GO-bp Annotation by Michelle Graham. GO Biological Process: nitric oxide biosynthetic process SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0008219GO-bp Annotation by Michelle Graham. GO Biological Process: cell death SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009743GO-bp Annotation by Michelle Graham. GO Biological Process: response to carbohydrate stimulus SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0009816GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010102GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root morphogenesis SoyBaseN/AISS
GO:0010193GO-bp Annotation by Michelle Graham. GO Biological Process: response to ozone SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0012501GO-bp Annotation by Michelle Graham. GO Biological Process: programmed cell death SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:2000377GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of reactive oxygen species metabolic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003950GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD+ ADP-ribosyltransferase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
UniRef100_A2Q3R6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Poly(ADP-ribose) polymerase, catalytic region n=1 Tax=Medicago truncatula RepID=A2Q3R6_MEDTR SoyBaseE_val: 1.00E-98ISS
UniRef100_UPI0002336DD8UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002336DD8 related cluster n=1 Tax=unknown RepID=UPI0002336DD8 SoyBaseE_val: 0ISS

Expression Patterns of Glyma01g01920
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g01920 not represented in the dataset
Glyma01g01920 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g01920 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g015200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g01920
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g01920
>Glyma01g01920.2   sequence type=CDS   gene model=Glyma01g01920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGGGGAGCAGGACGGGGGATATCATACTCATCCCTGCCCCGCCCCACCCCACCCGGTTGTCATGCCATCTCCTGCTTAACTTTTGCTACGAAGTTGTAAGCAAGACAGCTCAGTTGTTAGGTGTTTATTTCAAAGGCCTTTCAGTGAGAATAGGGATTGCCAAATATTCTGGATGTTATGGTCTTCACCATTGCCACCGCAGTTTCTTTGAAACTGCTCAAGGTCTAGGGTTCTATTTAACTTCTGCACCTGAGCTTTTATATTTAAGAGTGCTTATAGATATTGGGCTAGGTGATAGAAATGGAAGCAAAATCGCAAAGGAATTGAATAGGGTTGCACTCAATCTGAAGCGCAAGCAAGCGACCCGATATGCTGCACATTTAAGTGGAGCTTCCCAACCAATGTTAGGGCATTGGTCATCTCTTACGTCACCAGCAAGCAGGGCTGTCAAACGCATGAGATTGGGTGGATATAGAAACAGGCTGACAAATGCTGGTCGTCATATTGGACGGTCCTTAGCTAGGCGTTTTTTGAATTATAAAAAGAGTGGGAGACTGGAGCGTTTGATGTTCTATGAGAATGGGGAATGGTTGGACTTTCCAAAGGATGTTGTTGACTTGGTTAAGAAGGATCTTGAAGTCAAGAAGGCAGCTGTGGAGATAGAGTCAAATGGGTATCATCTTTTGTTTGATTTTTTACATCTGCATAAGGTGGACCTTAAAACTGGCTTGCAACAACCTATAGCTTTGATTGATGCGGCAGGGTGGTGTTTTTCCCCCGAAATCTATGCTGCTTCTGATGAAGAACCTTATAATTTGAGCAAACAGGAATGTGGAAGAAGTCCGGACTCATATGCATCTAACGAAATAAAATTACATTTAGAAGTTGACATAAATGGAGTGGATCAATCCAGGTTGAGTGAGTGCAGTGGGGAGTCCAATGCTCTAGTTAAGGGTATTCAAATTGATACTAAACAAAACTGCTGTCAATATGATGTAGAAGTTGAAGATAGCATTAACAAAAAGGACTGTGGAAATGTTGGTGAAGACATTCAGCAACATCAAGACATAGATTTAGATGCTTATACTGAATCAGTATATGGAATATTGGATCTGAATTCTGTACAAAAGATGTTTCTTAAGGGAATGAGTAGTTTTGGCAGTACTGATTCTGACATATTTGAGATTTACCAATGCTCAGGTGCGTCAATGCAAGCACGATGGGAGCTGTTCCAGAAGCAAGCTGAAATTAGCAAAAAGAATCATGGGGAAGCTAACATTCAGTATGATTGGCTTGCTTCTTCTAAAGGAGAACTATCTACAATGATGAACTATGGACTAAGTCATTATGGACTATCTGGATCAAAGTGCACATATGACATTGGTGTTCATCTTGCTGCTGTTACTTGCCCTGATGCCAGGTTCCTTACCTTCAAATGGTAG
Predicted protein sequences of Glyma01g01920
>Glyma01g01920.2   sequence type=predicted peptide   gene model=Glyma01g01920   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLGSRTGDIILIPAPPHPTRLSCHLLLNFCYEVVSKTAQLLGVYFKGLSVRIGIAKYSGCYGLHHCHRSFFETAQGLGFYLTSAPELLYLRVLIDIGLGDRNGSKIAKELNRVALNLKRKQATRYAAHLSGASQPMLGHWSSLTSPASRAVKRMRLGGYRNRLTNAGRHIGRSLARRFLNYKKSGRLERLMFYENGEWLDFPKDVVDLVKKDLEVKKAAVEIESNGYHLLFDFLHLHKVDLKTGLQQPIALIDAAGWCFSPEIYAASDEEPYNLSKQECGRSPDSYASNEIKLHLEVDINGVDQSRLSECSGESNALVKGIQIDTKQNCCQYDVEVEDSINKKDCGNVGEDIQQHQDIDLDAYTESVYGILDLNSVQKMFLKGMSSFGSTDSDIFEIYQCSGASMQARWELFQKQAEISKKNHGEANIQYDWLASSKGELSTMMNYGLSHYGLSGSKCTYDIGVHLAAVTCPDARFLTFKW*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo