SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g01370): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g01370): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g01370

Feature Type:gene_model
Chromosome:Gm01
Start:992663
stop:997177
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma01g01370
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G32060AT Annotation by Michelle Graham. TAIR10: phosphoribulokinase | chr1:11532668-11534406 FORWARD LENGTH=395 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009058GO-bp Annotation by Michelle Graham. GO Biological Process: biosynthetic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009773GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem I SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0018119GO-bp Annotation by Michelle Graham. GO Biological Process: peptidyl-cysteine S-nitrosylation SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008974GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoribulokinase activity SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
KOG4203 KOG Armadillo/beta-Catenin/plakoglobin JGI ISS
PTHR10285Panther URIDINE KINASE RELATED JGI ISS
PTHR10285:SF29Panther PHOSPHORIBULOKINASE JGI ISS
PF00485PFAM Phosphoribulokinase / Uridine kinase family JGI ISS
UniRef100_I1J4L6UniRef Annotation by Michelle Graham. Best UniRef hit: Phosphoribulokinase n=1 Tax=Glycine max RepID=I1J4L6_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1J4L6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Phosphoribulokinase n=1 Tax=Glycine max RepID=I1J4L6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma01g01370
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g01370 not represented in the dataset
Glyma01g01370 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma01g01370
ParalogEvidenceComments
Glyma09g34410 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma01g01370 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.01g010200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma01g01370
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma01g01370
>Glyma01g01370.1   sequence type=CDS   gene model=Glyma01g01370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGCTTGCACTGTCTACTCAACACAATCTCTGAGCACAAATTGCTCCATCTCAACCCCATCAAAGACGCAACTCAGTTTTTTCCACCAAAAGCAGGTAGTTTTCTGGAGGAACAGCAAGAAGGGCAGCTGCAGCAGCAGAAGAAGCTATGTGATAACATGTGCAGCAGGTGACTCACAGACAGTGGTGATTGGCCTGGCTGCAGACTCAGGGTGTGGGAAGAGCACCTTCATGAGGAGGCTGACCAGTGTGTTTGGAGGAGCAGCAGAGCCACCAAAGGGTGGCAACCCTGACTCCAACACTCTCATCAGTGACACCACCACTGTCATATGCTTGGATGATTACCACTCTTTGGACAGAACTGGAAGAAAGGAGAAGGGTGTCACTGCCCTTGACCCTAGAGCCAATGATTTTGATCTCATGTATGAACAAGTTAAAGCTCTTAAGGATGGAATTGCTGTTGAAAAACCAATCTACAACCATGTCACTGGTCTCTTGGATCCCCCTGAGCTCATTAAACCCCCCAAAATCTTAGTCATTGAAGGTTTGCACCCAATGTTTGATTCCCGTGTCAGAGATCTCTTGGACTTTAGCATCTACCTAGACATTAGCAATGAGGTCAAATTCGCTTGGAAAATTCAGAGAGACATGGCAGAGCGTGGACACAGTCTTGAAAGCATCAAGGCTAGCATTGAAGCAAGGAAGCCTGATTTTGAAGCATATATTGATCCACAAAAGCAATACGCAGATGCAGTGATAGAAGTGTTGCCAACGCAACTCATTCCAGATGACAACGAGGGTAAGATTTTGAGAGTGAGATTGATACAGAAAGAGGGGGTTAAGTACTTTAGCCCGGTTTACTTGTTTGATGATGGCTCTACCATTTCATGGATACCATGTGGAAGAAAGCTTACATGCTCCTACCCTGGCATCAAATTCTTCTATGGACCTGAGACTTACTACGGAAATGAGGTGTCAGTTGTAGAAATGGATGGACAATTTGACAGACTAGATGAACTAATATACGTTGAGAGCCACCTAAGCAACCTCTCTACAAAGTTCTATGGAGAGGTTACTCAACAGATGTTGAAGCATGCTGATTTTCCCGGCAGCAACAATGGAACAGGTCTCTTCCAAACCATAGTTGGTTTGAAGATAAGAGATCTATATGAGCAGCTAATAGCCAGCAAGGCTGAGACTCCAGTAGCTGCAAAAGCTTAG
Predicted protein sequences of Glyma01g01370
>Glyma01g01370.1   sequence type=predicted peptide   gene model=Glyma01g01370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAACTVYSTQSLSTNCSISTPSKTQLSFFHQKQVVFWRNSKKGSCSSRRSYVITCAAGDSQTVVIGLAADSGCGKSTFMRRLTSVFGGAAEPPKGGNPDSNTLISDTTTVICLDDYHSLDRTGRKEKGVTALDPRANDFDLMYEQVKALKDGIAVEKPIYNHVTGLLDPPELIKPPKILVIEGLHPMFDSRVRDLLDFSIYLDISNEVKFAWKIQRDMAERGHSLESIKASIEARKPDFEAYIDPQKQYADAVIEVLPTQLIPDDNEGKILRVRLIQKEGVKYFSPVYLFDDGSTISWIPCGRKLTCSYPGIKFFYGPETYYGNEVSVVEMDGQFDRLDELIYVESHLSNLSTKFYGEVTQQMLKHADFPGSNNGTGLFQTIVGLKIRDLYEQLIASKAETPVAAKA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo