Glyma01g00500 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma01g00500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma01g00500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma01g00500

Feature Type:	gene_model
Chromosome:	Gm01
Start:	285992
stop:	288741
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma01g00500

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G20700	AT	Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF581) \| chr5:7006178-7007003 REVERSE LENGTH=248	SoyBase	E_val: 3.00E-16	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006816	GO-bp	Annotation by Michelle Graham. GO Biological Process: calcium ion transport	SoyBase	N/A	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009750	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus	SoyBase	N/A	ISS
GO:0009963	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
PF04570	PFAM	Protein of unknown function (DUF581)	JGI		ISS
UniRef100_C6T1D3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T1D3_SOYBN	SoyBase	E_val: 4.00E-102	ISS
UniRef100_E4MWR8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: mRNA, clone: RTFL01-09-F11 n=1 Tax=Eutrema halophilum RepID=E4MWR8_THEHA	SoyBase	E_val: 7.00E-14	ISS

Expression Patterns of Glyma01g00500

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma01g00500 not represented in the dataset	Glyma01g00500 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma01g00500 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.01g002000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma01g00500

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma01g00500

Limit To All Plant Sequences

>Glyma01g00500.1   sequence type=CDS   gene model=Glyma01g00500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAATTCAAATTCTAATTCCAGAAAACCACCAAAGAATTGGAATAGGATGATTTTGGAGAGAGGGGTAGTTGGGTTGGGCATAGTAGCAGCCATGAACTCCACTGATGTTGTTGTCTCCTCTGCTAAAGCTGCTGCTAACTTTCGTGGAACCACAACCTATGACTATGGCATTTTCTATGCTTCCCCTCTCAACAATATTGGAACCCGCTTCCCTCATTTTCTCAATTCCTGCAATCTTTGCGACAAACATCTTCATGGGGTTGACATCTTCATTTACAGAGGCGAGAAAGCGTTTTGTAGTGCAGAATGCCGTGAGACACACATTAGCATTAGCAACGATGATCACCAAGACGTAGTCAAGTGCAGATCTCGTGTTGTAGAGCACAATCCTGTCACACTCACATCTTCTATTCTTGCTGCAGCATGA

Predicted protein sequences of Glyma01g00500

Limit To All Plant Sequences

>Glyma01g00500.1   sequence type=predicted peptide   gene model=Glyma01g00500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENSNSNSRKPPKNWNRMILERGVVGLGIVAAMNSTDVVVSSAKAAANFRGTTTYDYGIFYASPLNNIGTRFPHFLNSCNLCDKHLHGVDIFIYRGEKAFCSAECRETHISISNDDHQDVVKCRSRVVEHNPVTLTSSILAAA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain