SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.20g229900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.20g229900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.20g229900

Feature Type:gene_model
Chromosome:Gm20
Start:46410285
stop:46416473
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.20g229900
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G05030.1AT sodium hydrogen exchanger 2 JGI N/AIEA
GO:0006811GO-bp ion transport EnsemblGenomesN/AIEA
GO:0006812GO-bp cation transport EnsemblGenomesN/AIEA
GO:0006812GO-bp cation transport JGI N/AIEA
GO:0006814GO-bp sodium ion transport EnsemblGenomesN/AIEA
GO:0006885GO-bp regulation of pH EnsemblGenomesN/AIEA
GO:0009651GO-bp response to salt stress EnsemblGenomesN/AIEA
GO:0051453GO-bp regulation of intracellular pH EnsemblGenomesN/AIEA
GO:0055075GO-bp potassium ion homeostasis EnsemblGenomesN/AIEA
GO:0055085GO-bp transmembrane transport EnsemblGenomesN/AIEA
GO:0055085GO-bp transmembrane transport JGI N/AIEA
GO:0071805GO-bp potassium ion transmembrane transport EnsemblGenomesN/AIEA
GO:0090333GO-bp regulation of stomatal closure EnsemblGenomesN/AIEA
GO:0098719GO-bp sodium ion import across plasma membrane EnsemblGenomesN/AIEA
GO:1902600GO-bp proton transmembrane transport EnsemblGenomesN/AIEA
GO:0005774GO-cc vacuolar membrane EnsemblGenomesN/AIEA
GO:0005886GO-cc plasma membrane EnsemblGenomesN/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0016021GO-cc integral component of membrane EnsemblGenomesN/AIEA
GO:0016021GO-cc integral component of membrane JGI N/AIEA
GO:0015297GO-mf antiporter activity EnsemblGenomesN/AIEA
GO:0015299GO-mf solute:proton antiporter activity EnsemblGenomesN/AIEA
GO:0015299GO-mf solute:hydrogen antiporter activity JGI N/AIEA
GO:0015385GO-mf sodium:proton antiporter activity EnsemblGenomesN/AIEA
GO:0015386GO-mf potassium:proton antiporter activity EnsemblGenomesN/AIEA
KOG1965 KOG Sodium/hydrogen exchanger protein JGI N/AIEA
PTHR10110Panther SODIUM/HYDROGEN EXCHANGER JGI N/AIEA
PTHR10110:SF20Panther JGI N/AIEA
PF00999PFAM Sodium/hydrogen exchanger family JGI N/AIEA

Proteins Associated with Glyma.20g229900
LocusGene SymbolProtein Name
NHX1 sodium/hydrogen exchanger 1

Expression Patterns of Glyma.20g229900
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.20g229900 not represented in the dataset
Glyma.20g229900 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.20g229900
ParalogEvidenceComments
Glyma.10g158700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.20g229900 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma20g37370 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.20g229900
>Glyma.20g229900.1 sequence-type=CDS polypeptide=Glyma.20g229900.1.p locus=Glyma.20g229900 ID=Glyma.20g229900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGTTTTTGAAATCAGTACTGTTGTTTCAAAATTGCAAACGTTATCCACCTCAGACCATGCCTCCGTGGTCTCCATGAACTTATTTGTGGCACTTCTTTGTGGTTGTATTGTCCTTGGCCATCTTCTTGAGGAGAATCGGTGGATGAACGAGTCTATCACTGCTCTTTTGATTGGTGTTTGCACTGGCATAGTCATTTTGCTGTTTAGTGGTGGCAAAAGCTCGCATATTCTTGTTTTCAGTGAAGATCTTTTCTTTATATACCTTCTGCCGCCTATAATATTTAATGCCGGGTTTCAGGTGAAAAAGAAGCAGTTTTTTGTTAACTTCATGACCATCATGTTGTTTGGTGCTATTGGCACATTAATATCTTGTACCATCATAACTTTGGGTGCCACACAAATTTTTAAGAGGTTGGATGTTGGTCCACTGGAATTAGGGGATTTCCTAGCAATTGGTGCAATATTTGCTGCAACGGATTCTGTTTGCACATTGCAGGTGCTAAATCAGGATGAGACACCTTTGCTGTACAGTCTTGTATTTGGGGAGGGTGTTGTGAATGATGCTACATCAGTGGTGCTTTTCAATGCAATCCAAAGCTTTGACCTCAACCAAATCGACCCTTCAATTGCTGGGCACTTTTTGGGAAATTTCTTGTATCTATTTATTGCAAGCACAATGCTTGGAGTGTTGACAGGTCTACTTAGTGCTTACATTATTAAAAAGCTGTACATTGGCAGGCACTCTACAGATCGCGAGGTTGCTCTTATGATGTTAATGGCATACCTCTCCTACATGCTTGCTGAATTGTCCTATCTGAGTGGCATTCTCACTGTATTCTTTTGTGGGATTGTCATGTCTCATTATACCTGGCATAATGTGACTGAGAGTTCAAGAATCACTACCAAGCATTCTTTTGCAACCTTGTCTTTTGTTGCTGAGATCTTTATCTTCCTTTATGTTGGTATGGATGCCTTGGACATTGAAAAATGGAAATTTGTCAGTGATAGCCCTGGAACATCTGTAGCAACTAGTTCAGTATTGTTGGGTCTAATTCTTCTTGGAAGAGCAGCTTTTGTTTTCCCCTTATCCTTCCTATCCAACTTGGCTAAAAAATCACCAAATGAGAAAATCAGCTTCAGACAGCAAGTTATCATTTGGTGGGCTGGTCTTATGAGAGGTGCTGTTTCAATCGCACTTGCATATAATCAGTTCACCATGTCGGGGCACACTTCACTAAGAAGCAATGCAATCATGATCACAAGCACCATCACTGTTGTGCTTTTCAGCACAGTGGTGTTTGGTCTGTTGACTAAGCCACTAATAAGGCTTTTACTGCCCCATACTCCACATCATAAAGAATCAAGCATCACGATAACCACAGATCCATCTACTCCAAGTCCAAAATCAGTCACTGTCCCACTTCTTGGGAGTGCCCAAGAATCTGAAGTCGATATTGATGGCCATGATATTCATCGTCCAAGCAGCATCCGTGCTTTACTTTCCACTCCAACACACACTGTTCATCGCTTGTGGCGTAAGTTTGATGATGCATTCATGCGTCCTGTTTTTGGTGGCAGGGGTTTTGTTCCTATAGAACCTGGCTCACCAACTGAACGTAATGGCCATCAATGGCGTTGA
Predicted protein sequences of Glyma.20g229900
>Glyma.20g229900.1.p sequence-type=predicted peptide transcript=Glyma.20g229900.1 locus=Glyma.20g229900 ID=Glyma.20g229900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MVFEISTVVSKLQTLSTSDHASVVSMNLFVALLCGCIVLGHLLEENRWMNESITALLIGVCTGIVILLFSGGKSSHILVFSEDLFFIYLLPPIIFNAGFQVKKKQFFVNFMTIMLFGAIGTLISCTIITLGATQIFKRLDVGPLELGDFLAIGAIFAATDSVCTLQVLNQDETPLLYSLVFGEGVVNDATSVVLFNAIQSFDLNQIDPSIAGHFLGNFLYLFIASTMLGVLTGLLSAYIIKKLYIGRHSTDREVALMMLMAYLSYMLAELSYLSGILTVFFCGIVMSHYTWHNVTESSRITTKHSFATLSFVAEIFIFLYVGMDALDIEKWKFVSDSPGTSVATSSVLLGLILLGRAAFVFPLSFLSNLAKKSPNEKISFRQQVIIWWAGLMRGAVSIALAYNQFTMSGHTSLRSNAIMITSTITVVLFSTVVFGLLTKPLIRLLLPHTPHHKESSITITTDPSTPSPKSVTVPLLGSAQESEVDIDGHDIHRPSSIRALLSTPTHTVHRLWRKFDDAFMRPVFGGRGFVPIEPGSPTERNGHQWR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo