SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.20g080900

Feature Type:gene_model
Chromosome:Gm20
Start:30415421
stop:30420479
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.20g080900
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G34260.1AT transducin family protein / WD-40 repeat family protein JGI N/AIEA
GO:0006364GO-bp rRNA processing EnsemblGenomesN/AIEA
GO:0042273GO-bp ribosomal large subunit biogenesis EnsemblGenomesN/AIEA
GO:0005515GO-mf protein binding EnsemblGenomesN/AIEA
GO:0005515GO-mf protein binding JGI N/AIEA
KOG2444 KOG WD40 repeat protein JGI N/AIEA
PTHR22840Panther FAMILY NOT NAMED JGI N/AIEA
PF00400PFAM WD domain, G-beta repeat JGI N/AIEA

Expression Patterns of Glyma.20g080900
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.20g080900 not represented in the dataset
Glyma.20g080900 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.20g080900 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma20g20543 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.20g080900
>Glyma.20g080900.1 sequence-type=CDS polypeptide=Glyma.20g080900.1.p locus=Glyma.20g080900 ID=Glyma.20g080900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGCTGGAAGTTCATGCTCACACTGAGTCCTGCAGGGCTGCTCGATTCATCAACGGTGGACGTGCGATCTTGACAGGTTCTCCGGATTGCTTAATACTGGCTACAGATGTGGAAACTGGATCTACAATTGCTCGTCTTGATGATGCTCATGAGGCTGCGATAAATAGATTGATAAACTTGACTGAGTCAACTGTTGCCTCGGGAGATGATGAAGGTTGTATAAAGGTATGGGATATCAGAGAACGTTCTTGTTGCAATTCTTTTAATTCCCATGAAGATTACATTTCAGACATTACTTTTGTGTCTGATGCAATGAAACTGTTGGCAACAAGTGGAGATGGGACTCTGTCTGTTTGCAATCTTCGAAGAAATAAAGTGCAAGCTCAATCTGAATTTTCTGAAGATGAGCTACTGTCTGTGGTTTTAATGAAGCTTGATGAAGACAGGATTATTACCGGATCAGAGAATAGAATTATCAACCTGGTTGGGATATTACCAAACAGAGTCATCCAGCCAATTGCAGAACACTCAGAATATCCTGTTGAGTGTCTTGCATTCTCTCATGATAGGAAGTTTCTTGGAAGCATTTCCCATGATCAAATGTTAAAGCTATGGGACTTGGATAATATTCTACAAGGCTCAGGAAACACACAAAGTAATGAAGCTGGAGCTGTTGACAGTGACGATGATGAGATGGATCTAGATGATGATCCTTCAAAGAATAGTAAAGGGAACAAGAGAAAGAATGCAAATAATGGGAATGCCCTAGGTGGATCGAACAACTTCTTTGCAGATTTATAG
Predicted protein sequences of Glyma.20g080900
>Glyma.20g080900.1.p sequence-type=predicted peptide transcript=Glyma.20g080900.1 locus=Glyma.20g080900 ID=Glyma.20g080900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MLEVHAHTESCRAARFINGGRAILTGSPDCLILATDVETGSTIARLDDAHEAAINRLINLTESTVASGDDEGCIKVWDIRERSCCNSFNSHEDYISDITFVSDAMKLLATSGDGTLSVCNLRRNKVQAQSEFSEDELLSVVLMKLDEDRIITGSENRIINLVGILPNRVIQPIAEHSEYPVECLAFSHDRKFLGSISHDQMLKLWDLDNILQGSGNTQSNEAGAVDSDDDEMDLDDDPSKNSKGNKRKNANNGNALGGSNNFFADL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo