|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G12120.1 | AT | fatty acid desaturase 2 | JGI | N/A | IEA |
| GO:0006629 | GO-bp | lipid metabolic process | EnsemblGenomes | N/A | IEA |
| GO:0006629 | GO-bp | lipid metabolic process | JGI | N/A | IEA |
| GO:0055114 | GO-bp | oxidation-reduction process | EnsemblGenomes | N/A | IEA |
| GO:0055114 | GO-bp | oxidation-reduction process | JGI | N/A | IEA |
| GO:0016020 | GO-cc | membrane | EnsemblGenomes | N/A | IEA |
| GO:0016021 | GO-cc | integral component of membrane | EnsemblGenomes | N/A | IEA |
| GO:0016717 | GO-mf | oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water | EnsemblGenomes | N/A | IEA |
| GO:0016717 | GO-mf | oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water | JGI | N/A | IEA |
| PTHR19353 | Panther | FATTY ACID DESATURASE 2 | JGI | N/A | IEA |
| PTHR19353:SF7 | Panther | JGI | N/A | IEA | |
| PF00487 | PFAM | Fatty acid desaturase | JGI | N/A | IEA |
| PF11960 | PFAM | Domain of unknown function (DUF3474) | JGI | N/A | IEA |
| PWY-5995 | SoyCyc9 | linoleate biosynthesis I (plants) | Plant Metabolic Network | ISS | |
| GN7V-41684 | SoyCyc9-rxn | oleoyl-lipid 12-desaturase | Plant Metabolic Network | ISS |
| Locus | Gene Symbol | Protein Name |
|---|---|---|
| FAD2-2A | fatty acid desaturase-2 |
|
Glyma.19g147300 not represented in the dataset |
Glyma.19g147300 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma19g32930 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.19g147300.1 sequence-type=CDS polypeptide=Glyma.19g147300.1.p locus=Glyma.19g147300 ID=Glyma.19g147300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGGGTGACACTATGAAACGGGTGCCAATTGAAAAACCTCCATTTACTCTCAGCCAAATCAAGAAGGCTATTCCACCACACTTTTTCCAGCGTTCTGTTCTGCGCTCATTCTCATATCTCATTTATGACCTTACCATAGCCTTCTGCCTCTATTACATTGCCACCGATTACTTCCACAACCTTCCTCATCCTCTCACTTTCTTGGCATGGCCAATCTATTGGGCTGTGCAAGGATTCACCCTAGCTGGTCTTTGGGTCATTGCACATGACTGTGGCCACCATGCATTCAGAGATTACCAACTTCTTGATGATAACGTTGGCCTTGTTCTCCACTCTGCTCTATTAGTCCCATACTTTTCATGGAAATACAGCCATCGCCGTCACCACTCCAACACAGGTTCTCTTGAGCGAGATGAAGTGTTTGTACCAAAGCAGAAGTCTAGCACACATGTGGTGCATCACTTGTTCTCCACAATGCCACATTATCATGCAATGGACGCTACAAAGGCAATAAAGCCCATTTTGGGAGAGTATTATCGGTTTGACGAGACCCCATTTGTCAAGGCAATGTGGAGAGAGGCAAGAGAGTGTATTTATGTGGAACCAGATACTGAGAACAAAGGTGTATTTTGGTACAACAATAAGTTGTGA
>Glyma.19g147300.1.p sequence-type=predicted peptide transcript=Glyma.19g147300.1 locus=Glyma.19g147300 ID=Glyma.19g147300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MGDTMKRVPIEKPPFTLSQIKKAIPPHFFQRSVLRSFSYLIYDLTIAFCLYYIATDYFHNLPHPLTFLAWPIYWAVQGFTLAGLWVIAHDCGHHAFRDYQLLDDNVGLVLHSALLVPYFSWKYSHRRHHSNTGSLERDEVFVPKQKSSTHVVHHLFSTMPHYHAMDATKAIKPILGEYYRFDETPFVKAMWREARECIYVEPDTENKGVFWYNNKL*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||