Glyma.19g132500

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.19g132500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.19g132500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.19g132500

Feature Type:	gene_model
Chromosome:	Gm19
Start:	39349172
stop:	39351117
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.19g132500

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G56970.1	AT	basic helix-loop-helix (bHLH) DNA-binding superfamily protein	JGI	N/A	IEA
GO:0003677	GO-mf	DNA binding	EnsemblGenomes	N/A	IEA
GO:0046983	GO-mf	protein dimerization activity	JGI	N/A	IEA
PTHR13935	Panther	ACHAETE-SCUTE TRANSCRIPTION FACTOR-RELATED	JGI	N/A	IEA
PTHR13935:SF2	Panther		JGI	N/A	IEA
PF00010	PFAM	Helix-loop-helix DNA-binding domain	JGI	N/A	IEA

Expression Patterns of Glyma.19g132500

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.19g132500 not represented in the dataset	Glyma.19g132500 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.19g132500

Paralog	Evidence	Comments
Glyma.03g130400	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.
Glyma.03g130600	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.19g132500 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments

Coding sequences of Glyma.19g132500

Limit To All Plant Sequences

>Glyma.19g132500.1 sequence-type=CDS polypeptide=Glyma.19g132500.1.p locus=Glyma.19g132500 ID=Glyma.19g132500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGTTGCTTTGTTTTCTCCTCCAGTGTTCTCAACCAAGGGATGGCTTTTAGAAGAGGAGCCATTAAGCTATGATGTGTCTTCGGAGTACTCATTTCCCTATCAATTTTATTCACCACAGACACAGATTGAGGTTGAAATAGAAAGCTCAACTGCACCATCCCCTGATGACCCTGCCATGGTCAAGAAGCTTAGCCACAACGCTAGTGAACGTGATCGCCGCAAGAAGATCAATAACTTGGTTTCTTCACTTCGTTCACTTCTTCCGGTGGCTGATCAAACGAAAAAAATGAGCATTCCGGCTACAGTTTCGCGAGTCATAAAATACATACCTGAGTTACAACAGCAAGTGCAATCACTGACTAAGAAAAAAGAGGTGCTTCTTTGGAGAATCTCTCGGCAATTGCAAGGAGATGCAGTGAACAAAGAATCTCAAAGGAAAATTTCCCAACACAACTCTGAATTTGTTGTTTCAACAAGTAGGCTCAACGACTGTGAAGTTGTTGTTCACATTTCTTATGAGGCTCAAAAGGCTCCACTATCCGAGATCTTGCACTGTTTAGAAAATAATGGTCTTTATTTGCTAAATGGTTCTTCCTCTGAAACCTTTGGAGGAAGGGCTTTCCACAACTTGCATTTTCAGGTGGAAAAAACTCAGAGATTAGAGTCCGAGATTCTAACTGAGAACCTTTTGTCGATATATCAGAACCAAAGGATTTTATAA

Predicted protein sequences of Glyma.19g132500

Limit To All Plant Sequences

>Glyma.19g132500.1.p sequence-type=predicted peptide transcript=Glyma.19g132500.1 locus=Glyma.19g132500 ID=Glyma.19g132500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MVALFSPPVFSTKGWLLEEEPLSYDVSSEYSFPYQFYSPQTQIEVEIESSTAPSPDDPAMVKKLSHNASERDRRKKINNLVSSLRSLLPVADQTKKMSIPATVSRVIKYIPELQQQVQSLTKKKEVLLWRISRQLQGDAVNKESQRKISQHNSEFVVSTSRLNDCEVVVHISYEAQKAPLSEILHCLENNGLYLLNGSSSETFGGRAFHNLHFQVEKTQRLESEILTENLLSIYQNQRIL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain