Report for Sequence Feature Glyma.19G203300
| Feature Type: | gene_model |
| Chromosome: | Gm19 |
| Start: | 46522398 |
| stop: | 46522595 |
| Source: | JGI |
| Version: | Wm82.a4.v1 |
| High confidence: | yes |
| 
|
Annotations for Glyma.19G203300
Gene model name correspondences to Glyma.19G203300 Gene Call Version Wm82.a4.v1
Coding sequences of Glyma.19G203300
>Glyma.19g203300.1 sequence-type=CDS polypeptide=Glyma.19g203300.1.p locus=Glyma.19g203300 id=Glyma.19g203300.1.Wm82.a4.v1 annot-version=Wm82.a4.v1
ATGGAGTCTCAGGTGAAGCACGCACTTGTTGTCAAAGTTATGGGTCGTACTGGATCCAGAGGACAAGTGACCCAGGTTAGAGTGAAGTTTTTGGATGATCAGAACCGTCACATCATGAGGAATGTGAAAGGACCTGTGAGAGAAGGAGACATTCTCACCCTACTCGAGTCTGAAAGGGAAGCAAGAAGATTGCGCTAG
Predicted protein sequences of Glyma.19G203300
>Glyma.19g203300.1.p sequence-type=predicted peptide transcript=Glyma.19g203300.1 locus=Glyma.19g203300 id=Glyma.19g203300.1.p.Wm82.a4.v1 annot-version=Wm82.a4.v1
MESQVKHALVVKVMGRTGSRGQVTQVRVKFLDDQNRHIMRNVKGPVREGDILTLLESEREARRLR*