|
A previous version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT5G46290.3 | AT | 3-ketoacyl-acyl carrier protein synthase I | JGI | N/A | IEA |
GO:0016020 | GO-cc | membrane | EnsemblGenomes | N/A | IEA |
GO:0016021 | GO-cc | integral component of membrane | EnsemblGenomes | N/A | IEA |
FASYN-ELONG-PWY | SoyCyc9 | fatty acid elongation -- saturated | Plant Metabolic Network | ISS | |
PWY-5156 | SoyCyc9 | superpathway of fatty acid biosynthesis II (plant) | Plant Metabolic Network | ISS | |
PWY-5971 | SoyCyc9 | palmitate biosynthesis II (bacteria and plants) | Plant Metabolic Network | ISS | |
PWY-7388 | SoyCyc9 | octanoyl-[acyl-carrier protein] biosynthesis (mitochondria, yeast) | Plant Metabolic Network | ISS | |
GN7V-67204 | SoyCyc9-rxn | β-ketoacyl-acyl-carrier-protein synthase I | Plant Metabolic Network | ISS |
Glyma.18g270400 not represented in the dataset |
Glyma.18g270400 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
Corresponding Name | Annotation Version | Evidence | Comments |
---|---|---|---|
Glyma18g50580 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.18g270400.1 sequence-type=CDS polypeptide=Glyma.18g270400.1.p locus=Glyma.18g270400 ID=Glyma.18g270400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGAATTGGATCAAAACAATCCTAAAATTTAGGCCCCAACAATGCCGCCGCCAAGCGACGCACCTCCTCTGCGAAGCGCGTGTTCTTCGTGTCCGCTACGGTGGCGTCGAAGGTGTCCGCCCCGCAGCGGAAGAAGGACCCAAAGAAGCACGTGATTATCACGGGATGGGGCTCGCGTCAGTGTTCGGGAACGACGTGGAGGGATACTATGAGAAGCTTCTCGCCGGCCAGAGTAGCATCATCGCTCCTGCGCGCAGGTGCAGGCCACCAGGATCTCAGATCTATTCTCTCTTTCCACATTTCCTTCTTATTTTGTTAGTTTACATTTCTGTGAGACAATCCTTTTTGAGGCACCGTGAGAGCGTGGGTTTGGTTGATTAA
>Glyma.18g270400.1.p sequence-type=predicted peptide transcript=Glyma.18g270400.1 locus=Glyma.18g270400 ID=Glyma.18g270400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MNWIKTILKFRPQQCRRQATHLLCEARVLRVRYGGVEGVRPAAEEGPKEARDYHGMGLASVFGNDVEGYYEKLLAGQSSIIAPARRCRPPGSQIYSLFPHFLLILLVYISVRQSFLRHRESVGLVD*
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||