SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.18g207700

Feature Type:gene_model
Chromosome:Gm18
Start:49258361
stop:49259268
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.18g207700
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G55210.1AT Disease resistance-responsive (dirigent-like protein) family protein JGI N/AIEA
GO:0005576GO-cc extracellular region EnsemblGenomesN/AIEA
GO:0048046GO-cc apoplast EnsemblGenomesN/AIEA
GO:0016853GO-mf isomerase activity EnsemblGenomesN/AIEA
PTHR21495Panther NUCLEOPORIN-RELATED JGI N/AIEA
PF03018PFAM Dirigent-like protein JGI N/AIEA

Expression Patterns of Glyma.18g207700
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.18g207700
ParalogEvidenceComments
Glyma.07g157100 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.18g207700 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma18g43900 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.18g207700
>Glyma.18g207700.1 sequence-type=CDS polypeptide=Glyma.18g207700.1.p locus=Glyma.18g207700 ID=Glyma.18g207700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTTCATCCAATTCCTCATCTTTTCCCTCCTCTTCACTCCCTTCACGATCATCTCCACCATAGCCCATGACACCGATGATTTTGTGCGCACATTAGACCGCAAAATGTTGGGTTTGGACGAAAAGAAAGAAAAGTTCATCCATTTCAGGTTCTACTGGCATGACGCGATGAGTGGACGCAACCCTTCTTCAGTTGAAGTTGTGCCACCACCTTTGAAGAACTCAACCACGCGCTTTGGATTGGTGAACATGCTCGATAACCCTTTGACTTTGGGACCTCAATTGAACTCCAAGTTGGTGGGGCAAGCACAAGGGTTCTATGCTTCTACGTCACAAAGTGAGTTTGTTTTGCTCATGGCTATGAATCTTGTCATCACCGAAGGAAAGTACAATGGCAGCACCATCACTATTTTGGGGAGAAACCCTATTTACTATGAGGAGAGGGAGATGCCCGTGATTGGTGGAAGTGGCCTCTTTCGATTTGCTAGGGGATATGCTAAACTTAGAACTTACTGGTTCTCACCCTCCACCAGAGATGCCATTGTTGAGTACAATGTCTATGTTTTGCATTATTATTGA
Predicted protein sequences of Glyma.18g207700
>Glyma.18g207700.1.p sequence-type=predicted peptide transcript=Glyma.18g207700.1 locus=Glyma.18g207700 ID=Glyma.18g207700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MFIQFLIFSLLFTPFTIISTIAHDTDDFVRTLDRKMLGLDEKKEKFIHFRFYWHDAMSGRNPSSVEVVPPPLKNSTTRFGLVNMLDNPLTLGPQLNSKLVGQAQGFYASTSQSEFVLLMAMNLVITEGKYNGSTITILGRNPIYYEEREMPVIGGSGLFRFARGYAKLRTYWFSPSTRDAIVEYNVYVLHYY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo