Report for Sequence Feature Glyma.18g022700
| Feature Type: | gene_model |
| Chromosome: | Gm18 |
| Start: | 1651098 |
| stop: | 1652076 |
| Source: | JGI |
| Version: | Wm82.a4.v1 |
| High confidence: | yes |
| 
|
Annotations for Glyma.18g022700
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
| AT3G10985.1 | AT |
ATWI-12,SAG20,WI12 |
JGI | N/A | IEA |
| PTHR33703 | PantherFam |
OS07G0691300 PROTEIN |
JGI | N/A | IEA |
| PF07107 | Pfam |
Wound-induced protein WI12 |
JGI | N/A | IEA |
Proteins Associated with Glyma.18g022700
| Locus | Gene Symbol | Protein Name |
| | WI12 | wound-inducible protein 12 |
Gene model name correspondences to Glyma.18g022700 Gene Call Version Wm82.a4.v1
| Corresponding Name | Annotation Version | Evidence | Comments |
Coding sequences of Glyma.18g022700
>Glyma.18g022700.3 sequence-type=CDS polypeptide=Glyma.18g022700.3.p locus=Glyma.18g022700 id=Glyma.18g022700.3.Wm82.a4.v1 annot-version=Wm82.a4.v1
ATGCGCATGCTCACCGGCGACTCCGCCGCCGACAACTCCTTCCGATTCGTTCCGCAGTCCATCGCCGCCTTCGGCTCCACCGTCATCGTCGAGGGCTGCGACTCCGCCCGCAACATTGCCTGGGTCCACGCCTGGACCGTCACTGATGGGATGATCACTCAAATCAGAGAGTACTTCAACACCGCCCTCACCGTCACTCGCATCCACGATTCCGGCGAGATTGTTCCGGCCAGATCCGGCGCCGGCCGTTTGCCCTGCGTCTGGGAGAGCAGCGTCTCCGGTCGGGTCGGGAAATCCGTCCCCGGTTTGGTTCTCGCAATATAA
Predicted protein sequences of Glyma.18g022700
>Glyma.18g022700.3.p sequence-type=predicted peptide transcript=Glyma.18g022700.3 locus=Glyma.18g022700 id=Glyma.18g022700.3.p.Wm82.a4.v1 annot-version=Wm82.a4.v1
MRMLTGDSAADNSFRFVPQSIAAFGSTVIVEGCDSARNIAWVHAWTVTDGMITQIREYFNTALTVTRIHDSGEIVPARSGAGRLPCVWESSVSGRVGKSVPGLVLAI*