Glyma.18G040100

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.18G040100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.18G040100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.18G040100

Feature Type:	gene_model
Chromosome:	Gm18
Start:	3311512
stop:	3316969
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.18G040100

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G16710.1	AT	dehydroascorbate reductase 1	JGI	N/A	IEA
GO:0006749	GO-bp	glutathione metabolic process	EnsemblGenomes	N/A	IEA
GO:0005737	GO-cc	cytoplasm	EnsemblGenomes	N/A	IEA
GO:0004364	GO-mf	glutathione transferase activity	EnsemblGenomes	N/A	IEA
GO:0005515	GO-mf	protein binding	EnsemblGenomes	N/A	IEA
GO:0005515	GO-mf	protein binding	JGI	N/A	IEA
GO:0016740	GO-mf	transferase activity	EnsemblGenomes	N/A	IEA
KOG1422	KOG	Intracellular Cl- channel CLIC, contains GST domain	JGI	N/A	IEA
PTHR11260	Panther	GLUTATHIONE S-TRANSFERASE, GST, SUPERFAMILY, GST DOMAIN CONTAINING	JGI	N/A	IEA
PTHR11260:SF15	Panther		JGI	N/A	IEA
PF02798	PFAM	Glutathione S-transferase, N-terminal domain	JGI	N/A	IEA
PWY-2261	SoyCyc9	ascorbate glutathione cycle	Plant Metabolic Network		ISS
GN7V-48942	SoyCyc9-rxn	glutathione dehydrogenase (ascorbate)	Plant Metabolic Network		ISS

Proteins Associated with Glyma.18G040100

Locus	Gene Symbol	Protein Name
	DHAR3	dehydroascorbate reductase
	MDHAR-3a	DEHYDROASCORBATE REDUCTASE 3 gene a
	DHAR-3a	DHAR class glutathione S-transferase 3 gene a

Expression Patterns of Glyma.18G040100

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.18G040100 not represented in the dataset	Glyma.18G040100 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.18G040100

Paralog	Evidence	Comments
Glyma.11g216400	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.18G040100 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g040100	Wm82.a4.v1	ISS	As supplied by JGI
Glyma18g04510	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.18G040100

Limit To All Plant Sequences

>Glyma.18g040100.1 sequence-type=CDS polypeptide=Glyma.18g040100.1.p locus=Glyma.18g040100 ID=Glyma.18g040100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTCCGCTGTGAGAGTTCAAGTTTCGGCGTGTGCGGTTTCCGCCACCGTCAACCACCTTCGCCTCCGCCAAAACGCCGTCGTTTCCTTCAGGAAGAAGAAGCCTCTCACTCTCAGAGTGGTCTCAATGTCTTCCGTTCCTCCTTCCCAACCCTTCGAAATCGCCGTTAAAGCTTCCGTCACCACACCCAACAGGCTCGGCGACTGCCCTTTTTGCCAAAGGGTGCTGCTGACACTGGAGGAAAAACATCTACCTTATGACCCCAAGTTGGTGGATTTGACCAACAAGCCAGAATGGTTCCTTAAAGTCAACCCTGATGGTAAAGTTCCTGTCATAAAGTTTGATGAGAAGTGGGTTCCTGATTCAGATGTTATTACTCAAACATTGGAAGAGAAGTATCCCAGCCCACCATTGGTGACCCCACCTGAAAGGGCCACAGCGGGGTCAAAGATCTTTTCTACATTTATTGGATTTCTCAAGAGCAAGGATCCCAATGATGGAACAGAGCAAGCATTACTAAGTGAACTGAGCTCTTTCAATGATTACATCAAGGAAAATGGTCCTTTCATCAACGGTAGTGAGATATCTGCAGCTGACCTATCACTTGGACCAAAGCTATACCATTTGGAGATTGCTTTGGGGCATTATAAGAAATGGACAGTGCCTGATTCACTTACCTCTTTGAAGTCTTATATGAAGGCCATTTTCTCGAGGGAATCGTTCGTTAAAACAAGTGCACAACCACAGGATGTCATTGAAGGTTGGCGTCCTAAAGTGGAAGGCTAA

Predicted protein sequences of Glyma.18G040100

Limit To All Plant Sequences

>Glyma.18g040100.1.p sequence-type=predicted peptide transcript=Glyma.18g040100.1 locus=Glyma.18g040100 ID=Glyma.18g040100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MSAVRVQVSACAVSATVNHLRLRQNAVVSFRKKKPLTLRVVSMSSVPPSQPFEIAVKASVTTPNRLGDCPFCQRVLLTLEEKHLPYDPKLVDLTNKPEWFLKVNPDGKVPVIKFDEKWVPDSDVITQTLEEKYPSPPLVTPPERATAGSKIFSTFIGFLKSKDPNDGTEQALLSELSSFNDYIKENGPFINGSEISAADLSLGPKLYHLEIALGHYKKWTVPDSLTSLKSYMKAIFSRESFVKTSAQPQDVIEGWRPKVEG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain