|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G13120.1 | AT | embryo defective 1745 | JGI | N/A | IEA |
| GO:0006406 | GO-bp | mRNA export from nucleus | EnsemblGenomes | N/A | IEA |
| GO:0006446 | GO-bp | regulation of translational initiation | EnsemblGenomes | N/A | IEA |
| GO:0006449 | GO-bp | regulation of translational termination | EnsemblGenomes | N/A | IEA |
| GO:0016973 | GO-bp | poly(A)+ mRNA export from nucleus | EnsemblGenomes | N/A | IEA |
| GO:0016973 | GO-bp | poly(A)+ mRNA export from nucleus | JGI | N/A | IEA |
| GO:0005643 | GO-cc | nuclear pore | EnsemblGenomes | N/A | IEA |
| GO:0005643 | GO-cc | nuclear pore | JGI | N/A | IEA |
| GO:0005737 | GO-cc | cytoplasm | EnsemblGenomes | N/A | IEA |
| GO:0044614 | GO-cc | nuclear pore cytoplasmic filaments | EnsemblGenomes | N/A | IEA |
| GO:0000822 | GO-mf | inositol hexakisphosphate binding | EnsemblGenomes | N/A | IEA |
| GO:0005543 | GO-mf | phospholipid binding | EnsemblGenomes | N/A | IEA |
| GO:0031369 | GO-mf | translation initiation factor binding | EnsemblGenomes | N/A | IEA |
| PF07817 | PFAM | GLE1-like protein | JGI | N/A | IEA |
|
Glyma.18G013000 not represented in the dataset |
Glyma.18G013000 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.18g013000 | Wm82.a4.v1 | ISS | As supplied by JGI |
| Glyma18g01641 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.18g013000.1 sequence-type=CDS polypeptide=Glyma.18g013000.1.p locus=Glyma.18g013000 ID=Glyma.18g013000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGGCTAGAGGGTTCTTGAATACACTCCCAGCAAATCAATACACAGCTGTTTCGCTTAATGCATTATTGCAAATGGCTGGATTTGCTCTCTATAAAAGATATAAATCTCAATTCTTAAAGATGCTGAACGTCGTCTCTGAAAACTTTTTAGTTGATCTGAAATCACGGAATATACCAGAATTGACGAGGACGGTTACGGAGATACAGACTTACATAGAAGATAAGAAGTTCCTTCAAGAGCCAGAAAGATGGAGACAGCAGCCTAATTACGCACCAAACGGACGTTTTAATAATTATTGA
>Glyma.18g013000.1.p sequence-type=predicted peptide transcript=Glyma.18g013000.1 locus=Glyma.18g013000 ID=Glyma.18g013000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MARGFLNTLPANQYTAVSLNALLQMAGFALYKRYKSQFLKMLNVVSENFLVDLKSRNIPELTRTVTEIQTYIEDKKFLQEPERWRQQPNYAPNGRFNNY*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||