SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.17g182100

Feature Type:gene_model
Chromosome:Gm17
Start:22134814
stop:22136771
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.17g182100
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G07698.1AT ATPase, F1 complex, alpha subunit protein JGI N/AIEA
GO:0015986GO-bp ATP synthesis coupled proton transport EnsemblGenomesN/AIEA
GO:0015991GO-bp ATP hydrolysis coupled proton transport JGI N/AIEA
GO:0033178GO-cc proton-transporting two-sector ATPase complex, catalytic domain JGI N/AIEA
GO:0005524GO-mf ATP binding EnsemblGenomesN/AIEA
GO:0005524GO-mf ATP binding JGI N/AIEA
PTHR15184Panther ATP SYNTHASE JGI N/AIEA
PTHR15184:SF19Panther JGI N/AIEA
PF00006PFAM ATP synthase alpha/beta family, nucleotide-binding domain JGI N/AIEA
PF00306PFAM ATP synthase alpha/beta chain, C terminal domain JGI N/AIEA
PWY-7219SoyCyc9 adenosine ribonucleotides de novo biosynthesis Plant Metabolic Network ISS
PWY-7229SoyCyc9 superpathway of adenosine nucleotides de novo biosynthesis I Plant Metabolic Network ISS
PWY-841SoyCyc9 superpathway of purine nucleotides de novo biosynthesis I Plant Metabolic Network ISS

Expression Patterns of Glyma.17g182100
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.17g182100 not represented in the dataset
Glyma.17g182100 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.17g182100 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma17g22808 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.17g182100
>Glyma.17g182100.1 sequence-type=CDS polypeptide=Glyma.17g182100.1.p locus=Glyma.17g182100 ID=Glyma.17g182100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGGGAAAGTTAGAATAGAAACTACAAGCAACTACCCCCCAATAGGCACAAGAGCTGAAAGGCACTGTCCCGACAGGGGTAGGAGCAAAAGGCCACTCGACAAGAGGAAAGGCTTTCGTCTGTCCTTCATTGAAACACAAGCAAGAGACATATTGGCCTATATTCCAACCGATGTGATCTCCATTACTGCTGGACAAATATGTTTGAAAACAGAGTTCTTTTATCGCGGAATTAGACTTGCTATTAATGATGGCTTATCTGTCAGTCGCGTTGGGTCTGCTACTCAGTTGAAAGCTACGGAACAAGTCTGCGTCGTCGCCTTTGCTCAATTTGACTCAGACCTTGATGCTGCGACTCAGGCATTACTCAATAGTGGTGCAAGGCTTACAGAAGTACTAAAACAACCTCAATATGCATCACTTCCAATTGAAAAATGA
Predicted protein sequences of Glyma.17g182100
>Glyma.17g182100.1.p sequence-type=predicted peptide transcript=Glyma.17g182100.1 locus=Glyma.17g182100 ID=Glyma.17g182100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MGKVRIETTSNYPPIGTRAERHCPDRGRSKRPLDKRKGFRLSFIETQARDILAYIPTDVISITAGQICLKTEFFYRGIRLAINDGLSVSRVGSATQLKATEQVCVVAFAQFDSDLDAATQALLNSGARLTEVLKQPQYASLPIEK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo