SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.17g116000

Feature Type:gene_model
Chromosome:Gm17
Start:9171575
stop:9173844
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.17g116000
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G20110.1AT Dynein light chain type 1 family protein JGI N/AIEA
GO:0007017GO-bp microtubule-based process EnsemblGenomesN/AIEA
GO:0007017GO-bp microtubule-based process JGI N/AIEA
GO:0010970GO-bp transport along microtubule EnsemblGenomesN/AIEA
GO:0060271GO-bp cilium assembly EnsemblGenomesN/AIEA
GO:2000582GO-bp positive regulation of ATP-dependent microtubule motor activity, plus-end-directed EnsemblGenomesN/AIEA
GO:0005868GO-cc cytoplasmic dynein complex EnsemblGenomesN/AIEA
GO:0005875GO-cc microtubule associated complex JGI N/AIEA
GO:0030286GO-cc dynein complex EnsemblGenomesN/AIEA
GO:0008092GO-mf cytoskeletal protein binding EnsemblGenomesN/AIEA
GO:0008574GO-mf ATP-dependent microtubule motor activity, plus-end-directed EnsemblGenomesN/AIEA
GO:0045505GO-mf dynein intermediate chain binding EnsemblGenomesN/AIEA
GO:0051959GO-mf dynein light intermediate chain binding EnsemblGenomesN/AIEA
KOG3430 KOG Dynein light chain type 1 JGI N/AIEA
PTHR11886Panther DYNEIN LIGHT CHAIN JGI N/AIEA
PTHR11886:SF9Panther JGI N/AIEA
PF01221PFAM Dynein light chain type 1 JGI N/AIEA
GN7V-64911SoyCyc9-rxn dynein ATPase Plant Metabolic Network ISS

Expression Patterns of Glyma.17g116000
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.17g116000 not represented in the dataset
Glyma.17g116000 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.17g116000
ParalogEvidenceComments
Glyma.13g168300 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.17g116000 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma17g12491 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.17g116000
>Glyma.17g116000.1 sequence-type=CDS polypeptide=Glyma.17g116000.1.p locus=Glyma.17g116000 ID=Glyma.17g116000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCTAACCAAGACAAGCAACACAAGAGAGGGTTCATGTACATTTACAAAGGTGGCACAGGAAACCAGAGAAAGAAAGAGTTGGAGCATGGTGTGGGACAGGAGAAGAAGTCAAATTCACGCAGTTGGTTGAACAGGATTTCAAGAACTCGAATTTTTAATGATGGCCACAGAGACTTGGACATTGGAACAAGAGGAGAAGGAGAATTTGTTGAGGCAAGGAAATCAATGTCTTGCTTGGATTTAGGAACACCAGCAGGAGGGTATGTTGAGGGGAGAAAATCGGTGTCTTTCATAGAAGCGGCAGCATCACCAGCAGCAGCCATAGGAAGCATAGTTGAGGAGGGAAGAAAATCAGTGTCCCACATCGAGAAGAACTTTGCAGTAGAGGGAATGGTTGAAGCACGAAAGTCGGTGTCCCACATCGAAACGTTGTCCTCTGTGATTGCGTATCTTCAAGTTAAGGTTTTGGTCTCGGACATGCCAACCTTCATGCAAGTGCATGCCTTTCGTTGTGCGAGAAGGACATATGATAGCTTGGAGAAGTTTAGCGCAAAACTCATCGCTCATAACATAAAGAAGGAATTTGACAAAGCGTATGGTCCGGTCTGGCATTGCATTGTAGGCTCAAATTTTGGTTCATTTGTGACACATTCAACGGGGTGTTTTCTTTATTTTTCAATGGAAAATTTATATATACTACTGTTCAAGACCAAAGTTAAGAAGGCGTTGGATTAA
Predicted protein sequences of Glyma.17g116000
>Glyma.17g116000.1.p sequence-type=predicted peptide transcript=Glyma.17g116000.1 locus=Glyma.17g116000 ID=Glyma.17g116000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MANQDKQHKRGFMYIYKGGTGNQRKKELEHGVGQEKKSNSRSWLNRISRTRIFNDGHRDLDIGTRGEGEFVEARKSMSCLDLGTPAGGYVEGRKSVSFIEAAASPAAAIGSIVEEGRKSVSHIEKNFAVEGMVEARKSVSHIETLSSVIAYLQVKVLVSDMPTFMQVHAFRCARRTYDSLEKFSAKLIAHNIKKEFDKAYGPVWHCIVGSNFGSFVTHSTGCFLYFSMENLYILLFKTKVKKALD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo