Glyma.17g037200

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.17g037200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.17g037200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.17g037200

Feature Type:	gene_model
Chromosome:	Gm17
Start:	2709179
stop:	2712605
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.17g037200

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G54140.1	AT	TATA binding protein associated factor 21kDa subunit	JGI	N/A	IEA
GO:0006352	GO-bp	DNA-templated transcription, initiation	EnsemblGenomes	N/A	IEA
GO:0006352	GO-bp	DNA-templated transcription, initiation	JGI	N/A	IEA
GO:0006366	GO-bp	transcription by RNA polymerase II	EnsemblGenomes	N/A	IEA
GO:0043966	GO-bp	histone H3 acetylation	EnsemblGenomes	N/A	IEA
GO:0045944	GO-bp	positive regulation of transcription by RNA polymerase II	EnsemblGenomes	N/A	IEA
GO:0051123	GO-bp	RNA polymerase II transcriptional preinitiation complex assembly	EnsemblGenomes	N/A	IEA
GO:0000124	GO-cc	SAGA complex	EnsemblGenomes	N/A	IEA
GO:0005669	GO-cc	transcription factor TFIID complex	EnsemblGenomes	N/A	IEA
GO:0001075	GO-mf	transcription factor activity, RNA polymerase II core promoter sequence-specific binding involved in preinitiation complex assembly	EnsemblGenomes	N/A	IEA
GO:0004402	GO-mf	histone acetyltransferase activity	EnsemblGenomes	N/A	IEA
GO:0008134	GO-mf	transcription factor binding	EnsemblGenomes	N/A	IEA
GO:0044212	GO-mf	transcription regulatory region DNA binding	EnsemblGenomes	N/A	IEA
GO:0046982	GO-mf	protein heterodimerization activity	EnsemblGenomes	N/A	IEA
KOG3334	KOG	Transcription initiation factor TFIID, subunit TAF9 (also component of histone acetyltransferase SAGA)	JGI	N/A	IEA
PTHR12075	Panther	TRANSCRIPTION INITIATION FACTOR TFIID COMPONENT	JGI	N/A	IEA
PF02291	PFAM	Transcription initiation factor IID, 31kD subunit	JGI	N/A	IEA

Expression Patterns of Glyma.17g037200

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.17g037200 not represented in the dataset	Glyma.17g037200 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.17g037200

Paralog	Evidence	Comments
Glyma.07g236200	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.17g037200 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma17g04140	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.17g037200

Limit To All Plant Sequences

>Glyma.17g037200.1 sequence-type=CDS polypeptide=Glyma.17g037200.1.p locus=Glyma.17g037200 ID=Glyma.17g037200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGGTGACAAAGAGGAAGAGTCGGCAATGCCAAGGGACGCAAAGATTGTGAAGTCTTTGCTGAAATCAATGGGCGTGGAGGACTACGAACCTCGCGTCATTCACAAGTTTCTTGAGCTTTGGTATCGCTACGTCGTCGATGTCTTAACCGACGCACAAGTCTATTCAGAGCATGCTGGAAAACCTGCAATTGACTGTGACGACGTTAAGCTTGCGATTCAGTCCAAGGTCAACTTCAGCTTCTCGCAACCACCCCCTCGTGAGGTGCTTCTGGAGTTGGCTCAAAACCGCAACAAGATACCATTGCCAAAGACTATAGCAGGACCTGGTATCCCACTTCCACCTGATCAGGACACATTAATCAGTCCAAACTACCAGTTTGCAATTCCTAACAAAAGGCCTGCCCAACCTTTAGAAGAAACAGAGGATGAAGAAGCTACCATTCCCAATCCCTCTCAGGAACAGAAGGTAGACACGCAGCCGAATCCCCATCAGAGAGTGTCATTTCCCCTGCCCAAACGCCAAAAGGATTAA

Predicted protein sequences of Glyma.17g037200

Limit To All Plant Sequences

>Glyma.17g037200.1.p sequence-type=predicted peptide transcript=Glyma.17g037200.1 locus=Glyma.17g037200 ID=Glyma.17g037200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MGDKEEESAMPRDAKIVKSLLKSMGVEDYEPRVIHKFLELWYRYVVDVLTDAQVYSEHAGKPAIDCDDVKLAIQSKVNFSFSQPPPREVLLELAQNRNKIPLPKTIAGPGIPLPPDQDTLISPNYQFAIPNKRPAQPLEETEDEEATIPNPSQEQKVDTQPNPHQRVSFPLPKRQKD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain