SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.16g066200

Feature Type:gene_model
Chromosome:Gm16
Start:6576967
stop:6580036
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.16g066200
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G40650.1AT succinate dehydrogenase 2-2 JGI N/AIEA
GO:0006099GO-bp tricarboxylic acid cycle EnsemblGenomesN/AIEA
GO:0022900GO-bp electron transport chain EnsemblGenomesN/AIEA
GO:0055114GO-bp oxidation-reduction process EnsemblGenomesN/AIEA
GO:0005739GO-cc mitochondrion EnsemblGenomesN/AIEA
GO:0005743GO-cc mitochondrial inner membrane EnsemblGenomesN/AIEA
GO:0008177GO-mf succinate dehydrogenase (ubiquinone) activity EnsemblGenomesN/AIEA
GO:0009055GO-mf electron transfer activity EnsemblGenomesN/AIEA
GO:0009055GO-mf electron carrier activity JGI N/AIEA
GO:0016491GO-mf oxidoreductase activity EnsemblGenomesN/AIEA
GO:0046872GO-mf metal ion binding EnsemblGenomesN/AIEA
GO:0051536GO-mf iron-sulfur cluster binding EnsemblGenomesN/AIEA
GO:0051536GO-mf iron-sulfur cluster binding JGI N/AIEA
GO:0051537GO-mf 2 iron, 2 sulfur cluster binding EnsemblGenomesN/AIEA
GO:0051538GO-mf 3 iron, 4 sulfur cluster binding EnsemblGenomesN/AIEA
GO:0051539GO-mf 4 iron, 4 sulfur cluster binding EnsemblGenomesN/AIEA
KOG3049 KOG Succinate dehydrogenase, Fe-S protein subunit JGI N/AIEA
PTHR11921Panther SUCCINATE DEHYDROGENASE IRON-SULFUR PROTEIN JGI N/AIEA
PWY-3781SoyCyc9 aerobic respiration I (cytochrome c) Plant Metabolic Network ISS
PWY-4302SoyCyc9 aerobic respiration III (alternative oxidase pathway) Plant Metabolic Network ISS
PWY-5464SoyCyc9 superpathway of cytosolic glycolysis (plants), pyruvate dehydrogenase and TCA cycle Plant Metabolic Network ISS
PWY-561SoyCyc9 superpathway of glyoxylate cycle and fatty acid degradation Plant Metabolic Network ISS
PWY-5690SoyCyc9 TCA cycle II (plants and fungi) Plant Metabolic Network ISS
GN7V-41030SoyCyc9-rxn succinate dehydrogenase (ubiquinone) Plant Metabolic Network ISS

Expression Patterns of Glyma.16g066200
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.16g066200
ParalogEvidenceComments
Glyma.19g080600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.16g066200 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma16g07150 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.16g066200
>Glyma.16g066200.1 sequence-type=CDS polypeptide=Glyma.16g066200.1.p locus=Glyma.16g066200 ID=Glyma.16g066200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
GCCCAGCAGGTGGAGCCCAAGGCCCGCGAAACCCCGACCCTCAAAACCTTCCAAATCTACCGCTGGAACCCCGAAAACCCCTCAAAGCCCGAGCTCAAGGACTACCAGATCAACCTAAAGGAGTGTGGGCCCATGGTCCTCGACGCGCTCATCAAGATCAAGAACGAGATCGACCCGAGCCTCACGTTCCGCCGCTCGTGCCGCGAGGGGATCTGCGGCTCCTGCGCAATGAACATCGACGGCTGCAACGGCCTGGCGTGCCTCACCAAGATCCCCTCGGAAAAAAACTCCGCCGCCACGACGATCACTCCTCTGCCGCACATGTTCGTGATCAAGGACCTGAGTATCGAGCCCTGGCTGAGGAAGAACCCACCGGTGCCGGGAAAAGAGATTCTGCAGAGCAAGAAGGAGAGGGAGAAGCTCGACGGGATGTACGAGTGCATTCTCTGCGCCTGCTGTAGCACCTCTTGCCCCAGCTACTGGTGGAACCCCGAGTCCTATCTCGGTCCCGCTGCGTTGCTCCACGCTAATAGGTGGATAAGCGACAGCCGTGATGAGTACACTAAGGAGAGATTGGATGCCATTAATGATGAATTCAAGCTCTATCGCTGCCACACCATATTGAACTGTGCTCGTGCCTGCCCAAAGGGGTTGAACCCAGGAAAGCAAATCTCACATATCAAGTCACTTCAGCCTAAAGCTTAA
Predicted protein sequences of Glyma.16g066200
>Glyma.16g066200.1.p sequence-type=predicted peptide transcript=Glyma.16g066200.1 locus=Glyma.16g066200 ID=Glyma.16g066200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
AQQVEPKARETPTLKTFQIYRWNPENPSKPELKDYQINLKECGPMVLDALIKIKNEIDPSLTFRRSCREGICGSCAMNIDGCNGLACLTKIPSEKNSAATTITPLPHMFVIKDLSIEPWLRKNPPVPGKEILQSKKEREKLDGMYECILCACCSTSCPSYWWNPESYLGPAALLHANRWISDSRDEYTKERLDAINDEFKLYRCHTILNCARACPKGLNPGKQISHIKSLQPKA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo