|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G14080.1 | AT | Small nuclear ribonucleoprotein family protein | JGI | N/A | IEA |
| GO:0000290 | GO-bp | deadenylation-dependent decapping of nuclear-transcribed mRNA | EnsemblGenomes | N/A | IEA |
| GO:0000932 | GO-cc | P-body | EnsemblGenomes | N/A | IEA |
| GO:0005845 | GO-cc | mRNA cap binding complex | EnsemblGenomes | N/A | IEA |
| GO:1990726 | GO-cc | Lsm1-7-Pat1 complex | EnsemblGenomes | N/A | IEA |
| GO:0000339 | GO-mf | RNA cap binding | EnsemblGenomes | N/A | IEA |
| KOG1782 | KOG | Small Nuclear ribonucleoprotein splicing factor | JGI | N/A | IEA |
| PTHR15588 | Panther | LSM1 | JGI | N/A | IEA |
| PTHR15588:SF5 | Panther | JGI | N/A | IEA | |
| PF01423 | PFAM | LSM domain | JGI | N/A | IEA |
|
Glyma.16g009500 not represented in the dataset |
Glyma.16g009500 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma.07g040900 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma16g01160 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.16g009500.1 sequence-type=CDS polypeptide=Glyma.16g009500.1.p locus=Glyma.16g009500 ID=Glyma.16g009500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGGGGACACTTCGCTCTTTTGATCAATTTGCCAATGCAGTTCTTGAGGGTGCTTGTGAGAGAGTTATTGTTGGTGATCTGTATTGTGACATCCCTTTAGGTCTCTATGTGATCCGTGGGGAAAATGTTGTTCTAATTGGTGAGCTGGACTTGGAGAGGGAGGAACTTCCCGAACATATGACACGTGTTTCTACCGCAGAAATCAAGAGGGCACAGAAAGCAGAAAGGGAGGCTTCAGATCTGAAAGGGACTATGAGGAAAAGAATGGAATTCCTTGACTTTGACTAG
>Glyma.16g009500.1.p sequence-type=predicted peptide transcript=Glyma.16g009500.1 locus=Glyma.16g009500 ID=Glyma.16g009500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MGTLRSFDQFANAVLEGACERVIVGDLYCDIPLGLYVIRGENVVLIGELDLEREELPEHMTRVSTAEIKRAQKAEREASDLKGTMRKRMEFLDFD*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||