SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.15g272300

Feature Type:gene_model
Chromosome:Gm15
Start:50965263
stop:50965748
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.15g272300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G12630.1AT A20/AN1-like zinc finger family protein JGI N/AIEA
GO:0003677GO-mf DNA binding EnsemblGenomesN/AIEA
GO:0003677GO-mf DNA binding JGI N/AIEA
GO:0008270GO-mf zinc ion binding EnsemblGenomesN/AIEA
GO:0008270GO-mf zinc ion binding JGI N/AIEA
GO:0046872GO-mf metal ion binding EnsemblGenomesN/AIEA
KOG3173 KOG Predicted Zn-finger protein JGI N/AIEA
PTHR10634Panther AN1-TYPE ZINC FINGER PROTEIN JGI N/AIEA
PF01428PFAM AN1-like Zinc finger JGI N/AIEA
PF01754PFAM A20-like zinc finger JGI N/AIEA

Expression Patterns of Glyma.15g272300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.15g272300
ParalogEvidenceComments
Glyma.08g153200 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.15g272300 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma15g42740 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.15g272300
>Glyma.15g272300.1 sequence-type=CDS polypeptide=Glyma.15g272300.1.p locus=Glyma.15g272300 ID=Glyma.15g272300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCTCAGAAAACCGAGAAAGAAGAAACCGACTTCAAAGTTCCGGAAACGATTACGCTTTGCGTCAACAACTGCGGCGTCACCGGAAACCCTGCCACGAATAACATGTGCCAGAAGTGCTTCACTGCCTCTACCGCCACCACTTCCGGCGCCGGAGGTGCCGGAATAGCTTCTCCGGCGACCAGATCCGGCGTCTCCGCGCGTCCTCAGAAGAGATCTTTTCCTGAAGAGCCCTCGCCGGTGGCGGATCCTCCTTCTTCGGACCAGACGACGCCGTCGGAGGCGAAGCGCGTGGTCAACCGCTGCTCCGGATGCCGGCGGAAGGTCGGACTCACCGGATTCCGGTGCCGGTGCGGCGAGCTCTTCTGCGCCGAGCACCGGTACTCCGACCGCCACGACTGCAGCTATGACTACAAAGCCGCCGGAAGAGAAGCCATCGCGAGGGAGAATCCGGTGATCAGAGCTGCGAAGATCGTCAAAGTCTGA
Predicted protein sequences of Glyma.15g272300
>Glyma.15g272300.1.p sequence-type=predicted peptide transcript=Glyma.15g272300.1 locus=Glyma.15g272300 ID=Glyma.15g272300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MAQKTEKEETDFKVPETITLCVNNCGVTGNPATNNMCQKCFTASTATTSGAGGAGIASPATRSGVSARPQKRSFPEEPSPVADPPSSDQTTPSEAKRVVNRCSGCRRKVGLTGFRCRCGELFCAEHRYSDRHDCSYDYKAAGREAIARENPVIRAAKIVKV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo