|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G46210.1 | AT | cullin4 | JGI | N/A | IEA |
| GO:0006511 | GO-bp | ubiquitin-dependent protein catabolic process | EnsemblGenomes | N/A | IEA |
| GO:0006511 | GO-bp | ubiquitin-dependent protein catabolic process | JGI | N/A | IEA |
| GO:0016567 | GO-bp | protein ubiquitination | EnsemblGenomes | N/A | IEA |
| GO:0031461 | GO-cc | cullin-RING ubiquitin ligase complex | JGI | N/A | IEA |
| GO:0080008 | GO-cc | Cul4-RING E3 ubiquitin ligase complex | EnsemblGenomes | N/A | IEA |
| GO:0031625 | GO-mf | ubiquitin protein ligase binding | EnsemblGenomes | N/A | IEA |
| GO:0031625 | GO-mf | ubiquitin protein ligase binding | JGI | N/A | IEA |
| GO:0061630 | GO-mf | ubiquitin protein ligase activity | EnsemblGenomes | N/A | IEA |
| PTHR11932 | Panther | CULLIN | JGI | N/A | IEA |
| PTHR11932:SF53 | Panther | JGI | N/A | IEA | |
| PF00888 | PFAM | Cullin family | JGI | N/A | IEA |
|
Glyma.15g249700 not represented in the dataset |
Glyma.15g249700 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma15g39908 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.15g249700.1 sequence-type=CDS polypeptide=Glyma.15g249700.1.p locus=Glyma.15g249700 ID=Glyma.15g249700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGGGTGTAAATCTTCATCAACAGATTGAAAAGGAGTGTGAAGCACATATATCTGCTGCACTGCAGTCTTTGGTTGGCCAAAGCCCAGATTTGGTTGTTTTTCGGTCTCTAGTTGAGAGATGTTGGCAGGATCTTTGTGACCAAATGTTGATGATTCGTGGTATAGCCTTGTATCTAGATAGGACATATGTGAAGCAAACAGCAAATGTTCGATCATTATGGGACATGGGCTTACAACTTTTCCGCAAACATCTTTCATTGTCTCCTGAAGTAGAACACAAAACTGTTACTGGTCTTCTACGAATGATTGAAAGTGAAAGGAAATCAAATGCAATTGTCAAAGGCAAAAGAGTGTCAAATACCGTTGTATGA
>Glyma.15g249700.1.p sequence-type=predicted peptide transcript=Glyma.15g249700.1 locus=Glyma.15g249700 ID=Glyma.15g249700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MGVNLHQQIEKECEAHISAALQSLVGQSPDLVVFRSLVERCWQDLCDQMLMIRGIALYLDRTYVKQTANVRSLWDMGLQLFRKHLSLSPEVEHKTVTGLLRMIESERKSNAIVKGKRVSNTVV*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||