Glyma.15g222500

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.15g222500

Feature Type:	gene_model
Chromosome:	Gm15
Start:	40417551
stop:	40418575
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.15g222500

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G61750.1	AT	RmlC-like cupins superfamily protein	JGI	N/A	IEA
GO:0005576	GO-cc	extracellular region	EnsemblGenomes	N/A	IEA
GO:0005618	GO-cc	cell wall	EnsemblGenomes	N/A	IEA
GO:0030145	GO-mf	manganese ion binding	EnsemblGenomes	N/A	IEA
GO:0045735	GO-mf	nutrient reservoir activity	EnsemblGenomes	N/A	IEA
GO:0045735	GO-mf	nutrient reservoir activity	JGI	N/A	IEA
GO:0046872	GO-mf	metal ion binding	EnsemblGenomes	N/A	IEA
PF00190	PFAM	Cupin	JGI	N/A	IEA

Proteins Associated with Glyma.15g222500

Locus	Gene Symbol	Protein Name
	GER15	germin-like protein

Expression Patterns of Glyma.15g222500

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.15g222500

Paralog	Evidence	Comments
Glyma.08g226800	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.15g222500 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma15g35130	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.15g222500

Limit To All Plant Sequences

>Glyma.15g222500.1 sequence-type=CDS polypeptide=Glyma.15g222500.1.p locus=Glyma.15g222500 ID=Glyma.15g222500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGAAACTCTTTGCTCACTTTTTCTTTATGTTGTTGTTCTTGGTGGCCTTTTCCAACATCCAAGTTTGTTTGGGGGACTGTGATAATCTTCAGGACACTTGTCCAGCAGTTCCACCCAATAAGCAGACCATATTCATCAATGGTCTTCAATGCAAAAACCCAGTTAATGTAACAGCTCAAGATTTCAGGACCACAGAACTAAGCAAAACTGGCCCTAGAGACATTTTTGGTGCATCTTTGAAAATTGTGAGTGCTGCTGAGTTCATTGGCCTCAATACTCTTGGCCTCTCCATTGGAAGAACTGACCTTGATGGGAATGGCCTGGTGAACTTCCACTATCATCCTAGGGCTACTGAGATAATCTATGTCACCAAAGGGGTGTTGTTGGCTGGTTTTGTTGACACCAAAAACCAGTATTTCCAGAAGTTTCTTAAAGTAGGTGATGTCTTTGTGTTCCCCAAGGCTTTGTTCCACTTCTTTCTAAATACTGATTTTGAAGAAGCCACTGTTTTCTCAGTGTACAACAGCCAGAATCCTGGCTTTGTGTCCCTTAGTCCTACAACTTTTGACACAACATTGGAGTCATTGGACAAGATCAAGAAGAGACTCATCTCACTCTCTGCCTCTGAAGCTCAAGCTCAAGCTCAAGATGTCAACAGTTTCATCTCTCCAGAATTGGAAACCATTTACAGTTAG

Predicted protein sequences of Glyma.15g222500

Limit To All Plant Sequences

>Glyma.15g222500.1.p sequence-type=predicted peptide transcript=Glyma.15g222500.1 locus=Glyma.15g222500 ID=Glyma.15g222500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MKLFAHFFFMLLFLVAFSNIQVCLGDCDNLQDTCPAVPPNKQTIFINGLQCKNPVNVTAQDFRTTELSKTGPRDIFGASLKIVSAAEFIGLNTLGLSIGRTDLDGNGLVNFHYHPRATEIIYVTKGVLLAGFVDTKNQYFQKFLKVGDVFVFPKALFHFFLNTDFEEATVFSVYNSQNPGFVSLSPTTFDTTLESLDKIKKRLISLSASEAQAQAQDVNSFISPELETIYS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain