SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.13g088700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.13g088700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.13g088700

Feature Type:gene_model
Chromosome:Gm13
Start:20296948
stop:20300209
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.13g088700
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G35720.1AT annexin 1 JGI N/AIEA
GO:0006970GO-bp response to osmotic stress EnsemblGenomesN/AIEA
GO:0009408GO-bp response to heat EnsemblGenomesN/AIEA
GO:0009409GO-bp response to cold EnsemblGenomesN/AIEA
GO:0009414GO-bp response to water deprivation EnsemblGenomesN/AIEA
GO:0009651GO-bp response to salt stress EnsemblGenomesN/AIEA
GO:0009737GO-bp response to abscisic acid EnsemblGenomesN/AIEA
GO:0046686GO-bp response to cadmium ion EnsemblGenomesN/AIEA
GO:0070588GO-bp calcium ion transmembrane transport EnsemblGenomesN/AIEA
GO:0071435GO-bp potassium ion export EnsemblGenomesN/AIEA
GO:0098869GO-bp cellular oxidant detoxification EnsemblGenomesN/AIEA
GO:0005618GO-cc cell wall EnsemblGenomesN/AIEA
GO:0005739GO-cc mitochondrion EnsemblGenomesN/AIEA
GO:0005773GO-cc vacuole EnsemblGenomesN/AIEA
GO:0005774GO-cc vacuolar membrane EnsemblGenomesN/AIEA
GO:0005829GO-cc cytosol EnsemblGenomesN/AIEA
GO:0005886GO-cc plasma membrane EnsemblGenomesN/AIEA
GO:0009506GO-cc plasmodesma EnsemblGenomesN/AIEA
GO:0009507GO-cc chloroplast EnsemblGenomesN/AIEA
GO:0009570GO-cc chloroplast stroma EnsemblGenomesN/AIEA
GO:0009579GO-cc thylakoid EnsemblGenomesN/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0048046GO-cc apoplast EnsemblGenomesN/AIEA
GO:0004601GO-mf peroxidase activity EnsemblGenomesN/AIEA
GO:0005507GO-mf copper ion binding EnsemblGenomesN/AIEA
GO:0005509GO-mf calcium ion binding EnsemblGenomesN/AIEA
GO:0005509GO-mf calcium ion binding JGI N/AIEA
GO:0005524GO-mf ATP binding EnsemblGenomesN/AIEA
GO:0005544GO-mf calcium-dependent phospholipid binding EnsemblGenomesN/AIEA
GO:0005544GO-mf calcium-dependent phospholipid binding JGI N/AIEA
GO:0008270GO-mf zinc ion binding EnsemblGenomesN/AIEA
GO:0042803GO-mf protein homodimerization activity EnsemblGenomesN/AIEA
KOG0819 KOG Annexin JGI N/AIEA
PTHR10502Panther ANNEXIN JGI N/AIEA
PTHR10502:SF10Panther JGI N/AIEA
PF00191PFAM Annexin JGI N/AIEA
GN7V-66130SoyCyc9-rxn peroxidase Plant Metabolic Network ISS

Proteins Associated with Glyma.13g088700
LocusGene SymbolProtein Name
ANNEXIN annexin D1-like

Expression Patterns of Glyma.13g088700
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.13g088700 not represented in the dataset
Glyma.13g088700 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.13g088700 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma13g01870 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.13g088700
>Glyma.13g088700.1 sequence-type=CDS polypeptide=Glyma.13g088700.1.p locus=Glyma.13g088700 ID=Glyma.13g088700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCGACACTTAAGGTTCCTCAGCCTCTTCCCCCCGTTGCAGATGATTGTGAGCAGCTCCGAAAAGCCTTCTCAGGTTGGGGAACTAACGAGGAGCTGATTGTATCGATCTTGGCTCATAGGAATGCTGCTCAGAGGAAGCTTATCAGAGAAACTTATGCCCAGACCTATGGAGAAGATCTCCTCAAGGCCTTGGACAAAGAACTCACGAGTGATTTTGAGAGGCTGGTTCATCTTTGGACACTTGATTCTGCTGAACGTGATGCATTTTTGGCAAACGAGGCGACTAAAAAATGGACTTCAAGCAATCAGGTTCTGGTGGAAATAGCCTGCACTAGGTCCTCTGAACAATTGTTTGCTGCGAGGAAGGCTTACCATGTTCTTTATAAGAAGTCTCTGGAGGAGGATGTTGCTCATCACACAACAGGAGACTTCCGTAAGCTCATACTACCTCTGGTTAGTTCTTATCGATATGAAGGAGATGAGGTCAACTTGACCCTGGCAAAAACTGAGGCAAAATTGCTGCATGAGAAGATTTCAAACAAGGCTTATAATGATGACGACTTCATCAGGATTTTGGCCACAAGGAGCAGAGCACAGATTAATGCTACTTTGAATCACTACAAAGATGCATTTGGACAAGATATCAACAAGGACCTGAAGGCTGATCCAAAGGACGAGTTCCTGTCTTTACTAAGAGCAACTGTGAAGTGCTTGATCCGTCCCGAGAAGTACTTCGAGAAGGTTGTTCGCTTGGCGATCAACAAGCGAGGAACCGATGAAGGAGCCCTTACAAGAGTGGTGGCCACAAGGGCTGAGGTTGATTTGAAAAACATAGCAGATGAGTATCAAAGGAGGAGCAGTGTCCCTCTTGAACGTGCTATTGTTAAGGACACCACCGGTGACTATGAGAAAATGCTTGTGGCGCTTTTAGGACATGATGATGCTTGA
Predicted protein sequences of Glyma.13g088700
>Glyma.13g088700.1.p sequence-type=predicted peptide transcript=Glyma.13g088700.1 locus=Glyma.13g088700 ID=Glyma.13g088700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MATLKVPQPLPPVADDCEQLRKAFSGWGTNEELIVSILAHRNAAQRKLIRETYAQTYGEDLLKALDKELTSDFERLVHLWTLDSAERDAFLANEATKKWTSSNQVLVEIACTRSSEQLFAARKAYHVLYKKSLEEDVAHHTTGDFRKLILPLVSSYRYEGDEVNLTLAKTEAKLLHEKISNKAYNDDDFIRILATRSRAQINATLNHYKDAFGQDINKDLKADPKDEFLSLLRATVKCLIRPEKYFEKVVRLAINKRGTDEGALTRVVATRAEVDLKNIADEYQRRSSVPLERAIVKDTTGDYEKMLVALLGHDDA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo