SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.12g240900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.12g240900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.12g240900

Feature Type:gene_model
Chromosome:Gm12
Start:39950030
stop:39951659
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.12g240900
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G61760.1AT inositol polyphosphate kinase 2 beta JGI N/AIEA
GO:0016310GO-bp phosphorylation EnsemblGenomesN/AIEA
GO:0032958GO-bp inositol phosphate biosynthetic process EnsemblGenomesN/AIEA
GO:0000166GO-mf nucleotide binding EnsemblGenomesN/AIEA
GO:0000823GO-mf inositol-1,4,5-trisphosphate 6-kinase activity EnsemblGenomesN/AIEA
GO:0005524GO-mf ATP binding EnsemblGenomesN/AIEA
GO:0008440GO-mf inositol-1,4,5-trisphosphate 3-kinase activity EnsemblGenomesN/AIEA
GO:0008440GO-mf inositol-1,4,5-trisphosphate 3-kinase activity JGI N/AIEA
GO:0016301GO-mf kinase activity EnsemblGenomesN/AIEA
GO:0016740GO-mf transferase activity EnsemblGenomesN/AIEA
GO:0047326GO-mf inositol tetrakisphosphate 5-kinase activity EnsemblGenomesN/AIEA
GO:0102732GO-mf myo-inositol-1,2,3,4,6-heptakisphosphate 5-kinase activity EnsemblGenomesN/AIEA
KOG1620 KOG Inositol polyphosphate multikinase, component of the ARGR transcription regulatory complex JGI N/AIEA
PTHR12400Panther INOSITOL POLYPHOSPHATE KINASE JGI N/AIEA
PTHR12400:SF2Panther JGI N/AIEA
PF03770PFAM Inositol polyphosphate kinase JGI N/AIEA
PWY-4541SoyCyc9 lipid-dependent phytate biosynthesis I (via Ins(1,4,5)P3) Plant Metabolic Network ISS
PWY-4765SoyCyc9 superpathway of lipid-dependent phytate biosynthesis Plant Metabolic Network ISS
GN7V-62118SoyCyc9-rxn inositol-polyphosphate multikinase Plant Metabolic Network ISS

Proteins Associated with Glyma.12g240900
LocusGene SymbolProtein Name
IPK2 inositol polyphosphate 6-/3-/5-kinase

Expression Patterns of Glyma.12g240900
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.12g240900 not represented in the dataset
Glyma.12g240900 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.12g240900 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma12g36970 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.12g240900
>Glyma.12g240900.1 sequence-type=CDS polypeptide=Glyma.12g240900.1.p locus=Glyma.12g240900 ID=Glyma.12g240900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGCTCAAGATCCCGGAGCACCAGGTGGCCGGGCACAAGGCCAAGGACGGAATCCTGGGCCCACTCGTCGACGATTTTGGAAAATTCTACAAGCCCCTCCAGACCAACAAAGACGACGACACCCGCGGCTCCACCGAACTCTCCTTTTACACCTCTCTCGCCGCCGCCGCCCACGACTACTCCATCCGCTCCTTCTTCCCCGCCTTTCACGGCACCCGCCTCCTGGACGCCTCCGACGGCTCCGGTCCCCACCCTCACCTGGTCCTGGAGGACCTCCTCTGCGGCTACTCCAAACCCTCCGTCATGGACGTAAAGATCGGCTCCAGAACCTGGCACCTGGGAGACTCCGAGGACTACATCTGCAAGTGCCTGAAGAAGGACAGAGAGTCCTCTAGCTTGCCCTTGGGTTTCAGAATCTCGGGAGTCAAGGACTCTATCTCCTCCTGGGAACCTACCAGGAAATCTCTCCAGTGTCTATCCGCCCATGGTGTTGCACTTGTTCTCAACAAGTTCGTTTCCTCTAATAATATCAACCATGATGATCATCATCCCGATTGCGCTTTCGCAACGGAGGTCTACGGCGCCGTTTTGGAGCGCTTGCAGAAGCTCAAGGACTGGTTCGAGGTTCAGACGGTGTATCACTTCTATTCTTGTTCTGTTCTTGTGGTGTACGAGAAGGATCTAGGGAAAGGGAAAGCTACCAACCCTCTGGTCAAACTCGTTGACTTTGCACACGTGGTGGACGGAAACGGTGTCATTGATCACAACTTCTTGGGTGGCCTTTGTTCCTTCATCAAGTTCCTCAAGGATATCCTAGCAGTAGCATGTCTTCACAAGTGA
Predicted protein sequences of Glyma.12g240900
>Glyma.12g240900.1.p sequence-type=predicted peptide transcript=Glyma.12g240900.1 locus=Glyma.12g240900 ID=Glyma.12g240900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MLKIPEHQVAGHKAKDGILGPLVDDFGKFYKPLQTNKDDDTRGSTELSFYTSLAAAAHDYSIRSFFPAFHGTRLLDASDGSGPHPHLVLEDLLCGYSKPSVMDVKIGSRTWHLGDSEDYICKCLKKDRESSSLPLGFRISGVKDSISSWEPTRKSLQCLSAHGVALVLNKFVSSNNINHDDHHPDCAFATEVYGAVLERLQKLKDWFEVQTVYHFYSCSVLVVYEKDLGKGKATNPLVKLVDFAHVVDGNGVIDHNFLGGLCSFIKFLKDILAVACLHK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo