SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma.12g161200

Feature Type:gene_model
Chromosome:Gm12
Start:29673720
stop:29680486
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G16890.2AT ubiquitin-conjugating enzyme 36 JGI N/AIEA
GO:0006301GO-bp postreplication repair EnsemblGenomesN/AIEA
GO:0070534GO-bp protein K63-linked ubiquitination EnsemblGenomesN/AIEA
GO:0005634GO-cc nucleus EnsemblGenomesN/AIEA
GO:0005737GO-cc cytoplasm EnsemblGenomesN/AIEA
GO:0000166GO-mf nucleotide binding EnsemblGenomesN/AIEA
GO:0005524GO-mf ATP binding EnsemblGenomesN/AIEA
GO:0016740GO-mf transferase activity EnsemblGenomesN/AIEA
GO:0016881GO-mf acid-amino acid ligase activity JGI N/AIEA
GO:0031625GO-mf ubiquitin protein ligase binding EnsemblGenomesN/AIEA
GO:0061630GO-mf ubiquitin protein ligase activity EnsemblGenomesN/AIEA
KOG0417 KOG Ubiquitin-protein ligase JGI N/AIEA
PTHR24067Panther UBIQUITIN-CONJUGATING ENZYME E2 JGI N/AIEA
PTHR24067:SF30Panther JGI N/AIEA
PF00179PFAM Ubiquitin-conjugating enzyme JGI N/AIEA

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.



View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Corresponding NameAnnotation VersionEvidenceComments
Glyma20g10030 Wm82.a1.v1.1IGC As supplied by JGI


>Glyma.12g161200.1 sequence-type=CDS polypeptide=Glyma.12g161200.1.p locus=Glyma.12g161200 ID=Glyma.12g161200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCCAACAGCAACCTCCCTCGAAGAATCATCAAGGAAACGCAGCGTTTGCTCAGTGAGCCAGCACCAGGAATTAGTGCCTCCCCTTCTGAAGAGAATATGCGATATTTCAATGTGATGATCCTTGGGCCAACCCAGTCGCCTTATGAAGGAGGAGTTTTCAAGTTAGAACTATTTTTGCCAGAAGAATATCCAATGGCTGCTCCAAAGGTTAGGTTTCTAACAAAAATATATCATCCAAACATTGATAAGCTTGGCAGGATTTGTCTTGATATTCTGAAAGATAAGTGGAGTCCTGCCCTTCAGATCCGCACTGTTCTACTAAGCATTCAAGCTCTATTAAGTGCACCAAACCCAGATGATCCACTTTCTGAGAACATTGCCAAGCATTGGAAATCTAATGAGGCTGAGGCTGTCGAAACAGCGAAGGAATGGACCCGATTATATGCTAGTGGCGTCTGA

>Glyma.12g161200.1.p sequence-type=predicted peptide transcript=Glyma.12g161200.1 locus=Glyma.12g161200 ID=Glyma.12g161200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MANSNLPRRIIKETQRLLSEPAPGISASPSEENMRYFNVMILGPTQSPYEGGVFKLELFLPEEYPMAAPKVRFLTKIYHPNIDKLGRICLDILKDKWSPALQIRTVLLSIQALLSAPNPDDPLSENIAKHWKSNEAEAVETAKEWTRLYASGV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo