Glyma.12g129700

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.12g129700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.12g129700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.12g129700

Feature Type:	gene_model
Chromosome:	Gm12
Start:	14424463
stop:	14425697
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.12g129700

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G30970.1	AT	aspartate aminotransferase 1	JGI	N/A	IEA
GO:0016020	GO-cc	membrane	EnsemblGenomes	N/A	IEA
GO:0016021	GO-cc	integral component of membrane	EnsemblGenomes	N/A	IEA
GO:0003824	GO-mf	catalytic activity	EnsemblGenomes	N/A	IEA
GO:0004069	GO-mf	L-aspartate:2-oxoglutarate aminotransferase activity	EnsemblGenomes	N/A	IEA
ASPARTATE-DEG1-PWY	SoyCyc9	L-aspartate degradation I	Plant Metabolic Network		ISS
ASPARTATESYN-PWY	SoyCyc9	L-aspartate biosynthesis	Plant Metabolic Network		ISS
MALATE-ASPARTATE-SHUTTLE-PWY	SoyCyc9	L-aspartate degradation II	Plant Metabolic Network		ISS
PWY-3001	SoyCyc9	superpathway of L-isoleucine biosynthesis I	Plant Metabolic Network		ISS
THRESYN-PWY	SoyCyc9	superpathway of L-threonine biosynthesis	Plant Metabolic Network		ISS
GN7V-64674	SoyCyc9-rxn	aspartate transaminase	Plant Metabolic Network		ISS

Expression Patterns of Glyma.12g129700

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.12g129700 not represented in the dataset	Glyma.12g129700 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.12g129700

Paralog	Evidence	Comments
Glyma.06g275700	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.12g129700 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma12g15480	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.12g129700

Limit To All Plant Sequences

>Glyma.12g129700.1 sequence-type=CDS polypeptide=Glyma.12g129700.1.p locus=Glyma.12g129700 ID=Glyma.12g129700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCGATTTGCAACTCGCTCGCCGGCCGATTCCTCCGCCGAAGATCCATTTCCGGAGAAAGGCTCATCGAAATTGAATCTGTTGAGAAAGTGAAACTATCGAATCCGATCAGATCAACTAAGCAGAAAGCAGCACTGTTATATTCGTCACAGCAAATAGCAGTTTATTTTATTGGATTTGTTATGTTTATTTTTCGTGTTAAGAGTTCTGATTCGTGTATTTTGTCAGCAATGGAAAAAAAGGGTGCGTATCGCGATGACGACGGAAAACCTGTGGTTTTGGAATGTGTTAGAGAAGCAGAGAGGAGGATTGCCGGAAGTCAATTCATATCTTTGACATTTTACCCACTAACTGTTTTTGCCTTTTGGGTGTGTATGGACTGCACAAAACGCAGTTTTGGGAATAGGATACTGTTAGTTCTTGATGCGTCCTTTGATAACTACCCTCTTTATTCCCTTCCATAG

Predicted protein sequences of Glyma.12g129700

Limit To All Plant Sequences

>Glyma.12g129700.1.p sequence-type=predicted peptide transcript=Glyma.12g129700.1 locus=Glyma.12g129700 ID=Glyma.12g129700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MAICNSLAGRFLRRRSISGERLIEIESVEKVKLSNPIRSTKQKAALLYSSQQIAVYFIGFVMFIFRVKSSDSCILSAMEKKGAYRDDDGKPVVLECVREAERRIAGSQFISLTFYPLTVFAFWVCMDCTKRSFGNRILLVLDASFDNYPLYSLP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain