SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.12g119900

Feature Type:gene_model
Chromosome:Gm12
Start:12771082
stop:12774228
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.12g119900
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G28510.1AT Optic atrophy 3 protein (OPA3) JGI N/AIEA
GO:0019216GO-bp regulation of lipid metabolic process EnsemblGenomesN/AIEA
GO:0005739GO-cc mitochondrion EnsemblGenomesN/AIEA
KOG3335 KOG Predicted coiled-coil protein JGI N/AIEA
PTHR12499Panther OPTIC ATROPHY 3 PROTEIN (OPA3) JGI N/AIEA
PF07047PFAM Optic atrophy 3 protein (OPA3) JGI N/AIEA

Expression Patterns of Glyma.12g119900
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.12g119900 not represented in the dataset
Glyma.12g119900 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.12g119900
ParalogEvidenceComments
Glyma.06g285900 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.12g119900 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma12g14007 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.12g119900
>Glyma.12g119900.1 sequence-type=CDS polypeptide=Glyma.12g119900.1.p locus=Glyma.12g119900 ID=Glyma.12g119900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGTGGTGCTTCCGGTGGTGAAGCTAGCAACACTCGCTCTGAGAACCGCGTGCAAACCAATCGCCAACAGGCTCAAGAAGGAGGCCGGTTACCACCCCAAGTTCCGAAATTTCATCATCAGCATTGCCCAGGCCAATCATAGATTGACGACGAGAGTGCAGAGACGAATTTACAGTCATGCCACTGATGTTGCAATCCGCCCTTTGAACGAGGAGAAGGCTGTGCAAGCTGCTGCTGATCTGCTTGGAGAACTCTTTGTTTTCTCGGTTGCAGGAGCTGCCATCATCTTTGAGGTGCAAAGAAGTTCAAGATCAGAAGCAAGAAAAGAAGAACTACGTACACAGGAGATTGAGGAAATAAAGACTAAGAATGAAGAATTGGCTAGAGAAATTGCACTTCTTGCACAAAAGCTTGAAGAGCTGGAACAACTTTCCAGGGGACGAGGACTACTTGGCACTCTTAATATCAAACACAGTCGTGTCTCTCAAGATAGAAAATCTAATTGA
Predicted protein sequences of Glyma.12g119900
>Glyma.12g119900.1.p sequence-type=predicted peptide transcript=Glyma.12g119900.1 locus=Glyma.12g119900 ID=Glyma.12g119900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MVVLPVVKLATLALRTACKPIANRLKKEAGYHPKFRNFIISIAQANHRLTTRVQRRIYSHATDVAIRPLNEEKAVQAAADLLGELFVFSVAGAAIIFEVQRSSRSEARKEELRTQEIEEIKTKNEELAREIALLAQKLEELEQLSRGRGLLGTLNIKHSRVSQDRKSN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo