Glyma.11g081100

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.11g081100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.11g081100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.11g081100

Feature Type:	gene_model
Chromosome:	Gm11
Start:	6090248
stop:	6091010
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.11g081100

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
ATCG01010.1	AT	NADH-Ubiquinone oxidoreductase (complex I), chain 5 protein	JGI	N/A	IEA
GO:0042773	GO-bp	ATP synthesis coupled electron transport	EnsemblGenomes	N/A	IEA
GO:0055114	GO-bp	oxidation-reduction process	EnsemblGenomes	N/A	IEA
GO:0055114	GO-bp	oxidation-reduction process	JGI	N/A	IEA
GO:0009507	GO-cc	chloroplast	EnsemblGenomes	N/A	IEA
GO:0009535	GO-cc	chloroplast thylakoid membrane	EnsemblGenomes	N/A	IEA
GO:0009536	GO-cc	plastid	EnsemblGenomes	N/A	IEA
GO:0009579	GO-cc	thylakoid	EnsemblGenomes	N/A	IEA
GO:0016020	GO-cc	membrane	EnsemblGenomes	N/A	IEA
GO:0016021	GO-cc	integral component of membrane	EnsemblGenomes	N/A	IEA
GO:0008137	GO-mf	NADH dehydrogenase (ubiquinone) activity	EnsemblGenomes	N/A	IEA
GO:0008137	GO-mf	NADH dehydrogenase (ubiquinone) activity	JGI	N/A	IEA
GO:0016491	GO-mf	oxidoreductase activity	EnsemblGenomes	N/A	IEA
GO:0048038	GO-mf	quinone binding	EnsemblGenomes	N/A	IEA
PTHR22773	Panther	NADH DEHYDROGENASE	JGI	N/A	IEA
PTHR22773:SF39	Panther		JGI	N/A	IEA
PF00361	PFAM	NADH-Ubiquinone/plastoquinone (complex I), various chains	JGI	N/A	IEA
GN7V-55104	SoyCyc9-rxn	polyphosphate kinase	Plant Metabolic Network		ISS

Expression Patterns of Glyma.11g081100

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.11g081100 not represented in the dataset	Glyma.11g081100 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Gene model name correspondences to Glyma.11g081100 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma11g08601	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.11g081100

Limit To All Plant Sequences

>Glyma.11g081100.1 sequence-type=CDS polypeptide=Glyma.11g081100.1.p locus=Glyma.11g081100 ID=Glyma.11g081100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGTAACCATATGGTTTTCCTGTCATGCTCAGTGCATACTCCCATGCAACAATCTCATTAAACCTGACACGCAAACTGATAAACCACTATCTCCAATTTCCGCCCTTATACATGCTGCTATTATGGTAGCCGTGGGAATTTTTCTTGTAGCTCGACTTCTTCCTCTTTTCATAGTTCTAATTGCAATAATGAACGAAGTAGCTTTTATAGGTATAATAAGAATAGTATTAGGAGCTACCTTAGCTATTGCTCAACAAGATATTAACAAAAATTTGGCTTATTTCACAAAGTCTCAATTGGGTTATATGATGTTAGCGCTCAGTATGGGATCTTATCGAGTTGTTTTATTTCATTTGATTACTCATGCTTATTCAAAAGCATTGTTGTTTTTAGGATCCGGATCCATTATTCATTCAATGGAAGTTTTTGTCAGATATTCTCCAGCTAAAAGTCAAAATATGATTCTTATGGGCAGTTTAACAAAACATGTACCCATTACAAAAACTTCTTTTTTAGTGGATATGCTTTCTTTTTGCGGTATTCCACCTTTTGCCTGTTTTTGGTCTAAGGATGAGATTCTTAGTGATAATTGA

Predicted protein sequences of Glyma.11g081100

Limit To All Plant Sequences

>Glyma.11g081100.1.p sequence-type=predicted peptide transcript=Glyma.11g081100.1 locus=Glyma.11g081100 ID=Glyma.11g081100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MVTIWFSCHAQCILPCNNLIKPDTQTDKPLSPISALIHAAIMVAVGIFLVARLLPLFIVLIAIMNEVAFIGIIRIVLGATLAIAQQDINKNLAYFTKSQLGYMMLALSMGSYRVVLFHLITHAYSKALLFLGSGSIIHSMEVFVRYSPAKSQNMILMGSLTKHVPITKTSFLVDMLSFCGIPPFACFWSKDEILSDN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain