SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.11g070300

Feature Type:gene_model
Chromosome:Gm11
Start:5264434
stop:5266437
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.11g070300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G75280.1AT NmrA-like negative transcriptional regulator family protein JGI N/AIEA
GO:0006694GO-bp steroid biosynthetic process JGI N/AIEA
GO:0044237GO-bp cellular metabolic process JGI N/AIEA
GO:0055114GO-bp oxidation-reduction process JGI N/AIEA
GO:0003824GO-mf catalytic activity JGI N/AIEA
GO:0003854GO-mf 3-beta-hydroxy-delta5-steroid dehydrogenase activity JGI N/AIEA
GO:0016616GO-mf oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor JGI N/AIEA
GO:0050662GO-mf coenzyme binding JGI N/AIEA
PTHR10366Panther NAD DEPENDENT EPIMERASE/DEHYDRATASE JGI N/AIEA
PTHR10366:SF62Panther JGI N/AIEA
PF05368PFAM NmrA-like family JGI N/AIEA
PWY-5859SoyCyc9 eugenol and isoeugenol biosynthesis Plant Metabolic Network ISS
GN7V-50843SoyCyc9-rxn eugenol synthase Plant Metabolic Network ISS

Proteins Associated with Glyma.11g070300
LocusGene SymbolProtein Name
IFR1 isoflavone reductase homolog 1

Expression Patterns of Glyma.11g070300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.11g070300 not represented in the dataset
Glyma.11g070300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.11g070300
ParalogEvidenceComments
Glyma.01g172800 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.11g070300 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma11g07496 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.11g070300
>Glyma.11g070300.1 sequence-type=CDS polypeptide=Glyma.11g070300.1.p locus=Glyma.11g070300 ID=Glyma.11g070300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCAGCAAAGAGCAAAATCCTAGTCATTGGAGGAACAGGATACATTGGAAAATTCATAGTTAAGGCAAGTTCAGAAGCAGGACACCCCACATTTGCCTTGGTTAGAGAAAGCACCCTTTCTCATCCTGAAAAATTTAAACTTATTGAGAGCTTCAAGACCTCTGGAGTTACTCTCCTTTATGGTGATCTTACTGATCATGAAAGCCTTGTTAAGGCAATCAAACAAGTTGATGTTGTAATCTCCGCATTAGGTGCAGAACAGATCGATGATCAAGTGAAGATCATAGCAGCAATAAAAGAAGCCGGAAACATCAAGAGGCTCCTCCCATCGGAATTTGGGCACGACGTGGATCATCACAATGCAGTGGAACCAGTGAGTAGCTTCTTCGAGAAAAAAGTGAAAATCCGAAGGGCAATTGAAGCTGAAGGAATTCCATACACTTACATCAGTTCAAATTCCTTTGCTGGACACTTCCTACCTAACTTGTTACAACAAAATGTCACAGCTCCTCCCAGGGATGAGGTTGTCATTCTAGGAGATGGAAACATCAAAGGAGTTTATGTTATCGAGGAAGATGTTGCGACTTATACCATAAAAGCAGTGGATGACCCAAGAACCTTGAACAAAACTCTGTACCTGAGACCCCATGCCAATGTTTTGACCTTCAACGAGCTCGTGTCCTTGTGGGAGAACAAGATTAAGAGCACCCTTGACAAAATCTACGTTCCAGAAGATCAACTTCTGAAGAGCATCCAGGAGTCTTCTTTCCCTGCCAATTTCATGCTAGCATTAGGCCACTCAATGCTGGTAAAGGGAGATTGTAACTATGAGATTGACCCTTCTTTCGGTGTGGAAGCTTCTAAACTTTATCCTGAGGTGAAATACACTACTGTCGACAACTATTTGAATGCGTTTGTCTGA
Predicted protein sequences of Glyma.11g070300
>Glyma.11g070300.1.p sequence-type=predicted peptide transcript=Glyma.11g070300.1 locus=Glyma.11g070300 ID=Glyma.11g070300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MAAKSKILVIGGTGYIGKFIVKASSEAGHPTFALVRESTLSHPEKFKLIESFKTSGVTLLYGDLTDHESLVKAIKQVDVVISALGAEQIDDQVKIIAAIKEAGNIKRLLPSEFGHDVDHHNAVEPVSSFFEKKVKIRRAIEAEGIPYTYISSNSFAGHFLPNLLQQNVTAPPRDEVVILGDGNIKGVYVIEEDVATYTIKAVDDPRTLNKTLYLRPHANVLTFNELVSLWENKIKSTLDKIYVPEDQLLKSIQESSFPANFMLALGHSMLVKGDCNYEIDPSFGVEASKLYPEVKYTTVDNYLNAFV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo