Glyma.11g042200

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.11g042200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.11g042200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.11g042200

Feature Type:	gene_model
Chromosome:	Gm11
Start:	3090092
stop:	3092086
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.11g042200

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G32470.1	AT	Single hybrid motif superfamily protein	JGI	N/A	IEA
AT2G35370.1	AT	glycine decarboxylase complex H	JGI	N/A	IEA
GO:0006546	GO-bp	glycine catabolic process	JGI	N/A	IEA
GO:0019464	GO-bp	glycine decarboxylation via glycine cleavage system	EnsemblGenomes	N/A	IEA
GO:0005739	GO-cc	mitochondrion	EnsemblGenomes	N/A	IEA
GO:0005960	GO-cc	glycine cleavage complex	EnsemblGenomes	N/A	IEA
GO:0005960	GO-cc	glycine cleavage complex	JGI	N/A	IEA
KOG3373	KOG	Glycine cleavage system H protein (lipoate-binding)	JGI	N/A	IEA
PTHR11715	Panther	GLYCINE CLEAVAGE SYSTEM H PROTEIN	JGI	N/A	IEA
PF01597	PFAM	Glycine cleavage H-protein	JGI	N/A	IEA

Expression Patterns of Glyma.11g042200

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.11g042200 not represented in the dataset	Glyma.11g042200 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.11g042200

Paralog	Evidence	Comments
Glyma.01g199700	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.11g042200 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma11g04530	Wm82.a1.v1.1	IGC	As supplied by JGI

Transcripts of Glyma.11g042200

Limit To All Plant Sequences

>Glyma.11g042200.2 sequence-type=transcript locus=Glyma.11g042200 ID=Glyma.11g042200.2.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATTAATTAGCTTTTAGAAAAGAAAGAAAAACGGGAGTGCTGATTTTGATTCATTAGCGGATTGTTTAATTGAAATAGCAACAAGTTTAGCCTTGATTTTTTTTGTAAGGTTAGGCGAAGGATAATAAAAAACATAAGGCAGAACAAAAAGAGGATGAGGCATTCGCTGCCCACCATTCATCGAAGATAAACTTTGAAAAACCATATATGAAGAGCTCCATCTTATTGTTTCAGTGATATATTAATAATAACCAAAACAGCAGAGAGAAGAGAAGGGCTACACAAACACAATCTCTAATGGCACTCAGGATGTGGGCTTCTTCCACTGCCAATGCACTCAAACTCTCTTCTGTCTCCAGACCTCATCTCTTGCCTCCTTTTTCTTTCTCCAGATGCTTATCTTCCGTCTTGGATGGACTTAAGTACGCTGATTCACATGAATGGGTCAAGCACGAAGGCTCAGTCGCCACCATTGGTATCACTGACCATGCCCAGGACCATCTTGGAGAGGTTGTGTATGTGGAGCTGCCAGAACCAGGTGGCACAGTTTCCAAGAAGTCTGGCTTCGGAGCCGTTGAAAGTGTTAAAGCAACAAGTGATATAAACTCTCCAATCTCGGGGGAGATCGTTGAGGTTAACAAAAAGCTCACAGAAACGCCTGGCCTGGTGATCAATTCTAACCCTTACCCTATATCTCTGTACTATATATATATATTTGGTCTAAGGAGGACTTTTGTTGCAAAAAGCTAAAAAAAATTCAAGACCTGCGTGAGGTTACTTATTACCATGCACAGTTAGGGTAACAATATTTACACTATCAACAAATAAGAAATTATTTTAGGTATAACATTTAAAGTATTAATTATAAGAGTCAAAAAAATTATGGTACATATCAGTTTTTAATTGATTGACATTGTAAAAATCTCACACTATGGGTGCATATACTATTTACTCTTATGCATGACTATTTATTTTGATATTGAATTGAATTACAGTGTTGATTTGCCTTGTCTTCTAATCCGCAGTTTATATACAGCTCATATTTATTTTTCTACTTTTCCCACTTTAAGGTCAACTCAAGCCCATACGAAGATGGATGGATGATCAAAGTAAAGCCAAGCGATCCATCTGAATTAGATTCCTTGATGGGTCCAAAGGAGTACACAAAATTTTGTGAGGAAGAAGATGCAAGTCATTAAAGTTTGAATTGAATTGGCTCCTGCAGTTATGTGTGGGACTGACTGTTCTTCATATGTTTATGATCTTATTACCTTCTGAACAGTTTTTTAATATGCAACAGAACTGTTTCTTTCCATTTTTCCTTCCCCTGCTATTGTCTCTTGTCACCGACACTTCAGTGTGTCTACATTCTAATTTCTTTAATAAAAATATTTTTATTAAAGATAACTATTTTGTCAATATAATTACTGTGATTAATATT

Coding sequences of Glyma.11g042200

Limit To All Plant Sequences

>Glyma.11g042200.1 sequence-type=CDS polypeptide=Glyma.11g042200.1.p locus=Glyma.11g042200 ID=Glyma.11g042200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCACTCAGGATGTGGGCTTCTTCCACTGCCAATGCACTCAAACTCTCTTCTGTCTCCAGACCTCATCTCTTGCCTCCTTTTTCTTTCTCCAGATGCTTATCTTCCGTCTTGGATGGACTTAAGTACGCTGATTCACATGAATGGGTCAAGCACGAAGGCTCAGTCGCCACCATTGGTATCACTGACCATGCCCAGGACCATCTTGGAGAGGTTGTGTATGTGGAGCTGCCAGAACCAGGTGGCACAGTTTCCAAGAAGTCTGGCTTCGGAGCCGTTGAAAGTGTTAAAGCAACAAGTGATATAAACTCTCCAATCTCGGGGGAGATCGTTGAGGTTAACAAAAAGCTCACAGAAACGCCTGGCCTGGTCAACTCAAGCCCATACGAAGATGGATGGATGATCAAAGTAAAGCCAAGCGATCCATCTGAATTAGATTCCTTGATGGGTCCAAAGGAGTACACAAAATTTTGTGAGGAAGAAGATGCAAGTCATTAA

>Glyma.11g042200.2 sequence-type=CDS polypeptide=Glyma.11g042200.2.p locus=Glyma.11g042200 ID=Glyma.11g042200.2.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCACTCAGGATGTGGGCTTCTTCCACTGCCAATGCACTCAAACTCTCTTCTGTCTCCAGACCTCATCTCTTGCCTCCTTTTTCTTTCTCCAGATGCTTATCTTCCGTCTTGGATGGACTTAAGTACGCTGATTCACATGAATGGGTCAAGCACGAAGGCTCAGTCGCCACCATTGGTATCACTGACCATGCCCAGGACCATCTTGGAGAGGTTGTGTATGTGGAGCTGCCAGAACCAGGTGGCACAGTTTCCAAGAAGTCTGGCTTCGGAGCCGTTGAAAGTGTTAAAGCAACAAGTGATATAAACTCTCCAATCTCGGGGGAGATCGTTGAGGTTAACAAAAAGCTCACAGAAACGCCTGGCCTGGTGATCAATTCTAACCCTTACCCTATATCTCTGTACTATATATATATATTTGGTCTAAGGAGGACTTTTGTTGCAAAAAGCTAA

Predicted protein sequences of Glyma.11g042200

Limit To All Plant Sequences

>Glyma.11g042200.1.p sequence-type=predicted peptide transcript=Glyma.11g042200.1 locus=Glyma.11g042200 ID=Glyma.11g042200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MALRMWASSTANALKLSSVSRPHLLPPFSFSRCLSSVLDGLKYADSHEWVKHEGSVATIGITDHAQDHLGEVVYVELPEPGGTVSKKSGFGAVESVKATSDINSPISGEIVEVNKKLTETPGLVNSSPYEDGWMIKVKPSDPSELDSLMGPKEYTKFCEEEDASH*

>Glyma.11g042200.2.p sequence-type=predicted peptide transcript=Glyma.11g042200.2 locus=Glyma.11g042200 ID=Glyma.11g042200.2.Wm82.a2.v1 annot-version=Wm82.a2.v1
MALRMWASSTANALKLSSVSRPHLLPPFSFSRCLSSVLDGLKYADSHEWVKHEGSVATIGITDHAQDHLGEVVYVELPEPGGTVSKKSGFGAVESVKATSDINSPISGEIVEVNKKLTETPGLVINSNPYPISLYYIYIFGLRRTFVAKS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain