SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.10g213400): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.10g213400): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.10g213400

Feature Type:gene_model
Chromosome:Gm10
Start:44577721
stop:44580859
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.10g213400
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52300.1AT ATP synthase D chain, mitochondrial JGI N/AIEA
GO:0006811GO-bp ion transport EnsemblGenomesN/AIEA
GO:0015986GO-bp ATP synthesis coupled proton transport EnsemblGenomesN/AIEA
GO:0015986GO-bp ATP synthesis coupled proton transport JGI N/AIEA
GO:0099132GO-bp ATP hydrolysis coupled cation transmembrane transport EnsemblGenomesN/AIEA
GO:0000274GO-cc mitochondrial proton-transporting ATP synthase, stator stalk EnsemblGenomesN/AIEA
GO:0000276GO-cc mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) EnsemblGenomesN/AIEA
GO:0000276GO-cc mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) JGI N/AIEA
GO:0005739GO-cc mitochondrion EnsemblGenomesN/AIEA
GO:0005743GO-cc mitochondrial inner membrane EnsemblGenomesN/AIEA
GO:0009535GO-cc chloroplast thylakoid membrane EnsemblGenomesN/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0015078GO-mf proton transmembrane transporter activity EnsemblGenomesN/AIEA
GO:0015078GO-mf hydrogen ion transmembrane transporter activity JGI N/AIEA
GO:0046933GO-mf proton-transporting ATP synthase activity, rotational mechanism EnsemblGenomesN/AIEA
KOG3366 KOG Mitochondrial F1F0-ATP synthase, subunit d/ATP7 JGI N/AIEA
PTHR12700Panther FAMILY NOT NAMED JGI N/AIEA
PTHR12700:SF9Panther JGI N/AIEA
PF05873PFAM ATP synthase D chain, mitochondrial (ATP5H) JGI N/AIEA

Expression Patterns of Glyma.10g213400
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.10g213400 not represented in the dataset
Glyma.10g213400 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.10g213400
ParalogEvidenceComments
Glyma.20g177700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.10g213400 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma10g35750 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.10g213400
>Glyma.10g213400.1 sequence-type=CDS polypeptide=Glyma.10g213400.1.p locus=Glyma.10g213400 ID=Glyma.10g213400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGAGCGGAACGGTGAAGAAAGTAACCGATGTAGCATTCAAGGTGGGAAGGAACATCGATTGGGATGGAATGGCGAAGCTTCTCGTCTCCGATGAGGCTCGCAGGGAGTTCTCCAATCTCCGTCGCGCTTTCGACGAGGTTAACTCCCAACTCGAAACCAAGTTCAGCCAGGAACCTGAACCCATAGACTGGGATTACTATAGAAAAGGAATTGGCACTCGCTTGGTGGATATGTACAAGGAGCATTATGAGAGCATTGAGGTCCCCAAGTTTGTTGACACAGTAACTCCTCAATACAAGACTAAATTTGATGCCCTATTGATTGAGCTTAAAGAAGCAGAGGAGAAATCTCTGAAGGAGTCTGAGCGTTTGGAAAAGGAAATTGTTGAAGTACAAGAGTTGAAGAAAAAGCTCAGTACCATGACGGCAGATGAGTACTTTGAAAAACATCCTGAGCTGAGGAAGAAGTTTGATGATGAGATCAGAAATGATAACTGGGGCTATTGA
Predicted protein sequences of Glyma.10g213400
>Glyma.10g213400.1.p sequence-type=predicted peptide transcript=Glyma.10g213400.1 locus=Glyma.10g213400 ID=Glyma.10g213400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MSGTVKKVTDVAFKVGRNIDWDGMAKLLVSDEARREFSNLRRAFDEVNSQLETKFSQEPEPIDWDYYRKGIGTRLVDMYKEHYESIEVPKFVDTVTPQYKTKFDALLIELKEAEEKSLKESERLEKEIVEVQELKKKLSTMTADEYFEKHPELRKKFDDEIRNDNWGY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo