Report for Sequence Feature Glyma.10g063500
Feature Type: gene_model
Chromosome: Gm10
Start: 6003921
stop: 6006192
Source: JGI
Version: Wm82.a2.v1
High confidence: yes
A previous version of this gene model can be found here:
Annotations for Glyma.10g063500
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G03560.1 AT
Tetratricopeptide repeat (TPR)-like superfamily protein
JGI N/A IEA
GO:0000301 GO-bp
retrograde transport, vesicle recycling within Golgi
EnsemblGenomes N/A IEA
GO:0006890 GO-bp
retrograde vesicle-mediated transport, Golgi to ER
EnsemblGenomes N/A IEA
GO:0007030 GO-bp
Golgi organization
EnsemblGenomes N/A IEA
GO:0048213 GO-bp
Golgi vesicle prefusion complex stabilization
EnsemblGenomes N/A IEA
GO:0017119 GO-cc
Golgi transport complex
EnsemblGenomes N/A IEA
PF09350 PFAM
Domain of unknown function (DUF1992)
JGI N/A IEA
Expression Patterns of Glyma.10g063500
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Related Legume Genes
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS .
Gene information in GlycineMine developed by LIS .
Related Plant Genes
Gene families from PhyloGenes .
Paralogs of Glyma.10g063500
Paralog Evidence Comments
Glyma.13g148000 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.
Gene model name correspondences to Glyma.10g063500 Gene Call Version Wm82.a2.v1
Corresponding Name Annotation Version Evidence Comments
Glyma10g07260 Wm82.a1.v1.1 IGC As supplied by JGI
Coding sequences of Glyma.10g063500
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma.10g063500.1 sequence-type=CDS polypeptide=Glyma.10g063500.1.p locus=Glyma.10g063500 ID=Glyma.10g063500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCGACGTGTCTTCGCCTTGGGAGATTTACGACTATTGATTCGCTCTCTCTCTTCGTTTCCACCGCTAGATTCTCCTTTTCTTCATCATCTTCGTCGTCGTCCTCGTCGTCATCTTCCGGTAAGTCCAAGACGGGGAAGAAGCTGATGGATCGTCTTTCCACCGTTATCGACGCCGTCAATGATCGCAAACTACCTCCTGAGCTACGTGGCCAGCGCAGCAATGTCAGGTCAGAAACTGACATTATCAACGTTGTTGAGCAAAGAATATGGCATACCATGGAAGAAGGGAAGTTTGAGAATTTGCCAGGCAAAGGCAAGCCGCTTAAGCTCGACACAAATCCTCATGCAGATCCAGCTGAAGACACCCTGTACCGTATCCTGTCAAAAAACGGATATGCACCGGAGTGGGTTGAACTTAACAAAGAGATTAGATCTAAAATATCTGAATGGAGGAAGTCCTTGAAGAAAGCTTGGGCTACTAAGTGCAGTGGAGATCACTCTGAGTGGGTTGAAAGTTCAGAGGCTTTGAAATCTCAGTTACGAGAAATCAATGATAAGGTTTTCCGTTATAACCTTATTGTGCCTTTTGGTCGGCAAATGTTTGGCCTTAAGTGGGAGAAAGAGCTAGGTTACTTAGAAGAAAAATGA
Predicted protein sequences of Glyma.10g063500
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma.10g063500.1.p sequence-type=predicted peptide transcript=Glyma.10g063500.1 locus=Glyma.10g063500 ID=Glyma.10g063500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MATCLRLGRFTTIDSLSLFVSTARFSFSSSSSSSSSSSSSGKSKTGKKLMDRLSTVIDAVNDRKLPPELRGQRSNVRSETDIINVVEQRIWHTMEEGKFENLPGKGKPLKLDTNPHADPAEDTLYRILSKNGYAPEWVELNKEIRSKISEWRKSLKKAWATKCSGDHSEWVESSEALKSQLREINDKVFRYNLIVPFGRQMFGLKWEKELGYLEEK*