SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.10g014300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.10g014300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.10g014300

Feature Type:gene_model
Chromosome:Gm10
Start:1278620
stop:1283265
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.10g014300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G14290.1AT 20S proteasome alpha subunit E2 JGI N/AIEA
GO:0006508GO-bp proteolysis EnsemblGenomesN/AIEA
GO:0006511GO-bp ubiquitin-dependent protein catabolic process EnsemblGenomesN/AIEA
GO:0006511GO-bp ubiquitin-dependent protein catabolic process JGI N/AIEA
GO:0043161GO-bp proteasome-mediated ubiquitin-dependent protein catabolic process EnsemblGenomesN/AIEA
GO:0051603GO-bp proteolysis involved in cellular protein catabolic process EnsemblGenomesN/AIEA
GO:0051603GO-bp proteolysis involved in cellular protein catabolic process JGI N/AIEA
GO:0000502GO-cc proteasome complex EnsemblGenomesN/AIEA
GO:0005634GO-cc nucleus EnsemblGenomesN/AIEA
GO:0005737GO-cc cytoplasm EnsemblGenomesN/AIEA
GO:0005839GO-cc proteasome core complex EnsemblGenomesN/AIEA
GO:0005839GO-cc proteasome core complex JGI N/AIEA
GO:0019773GO-cc proteasome core complex, alpha-subunit complex EnsemblGenomesN/AIEA
GO:0019773GO-cc proteasome core complex, alpha-subunit complex JGI N/AIEA
GO:0004175GO-mf endopeptidase activity EnsemblGenomesN/AIEA
GO:0004175GO-mf endopeptidase activity JGI N/AIEA
GO:0004298GO-mf threonine-type endopeptidase activity EnsemblGenomesN/AIEA
GO:0004298GO-mf threonine-type endopeptidase activity JGI N/AIEA
GO:0008233GO-mf peptidase activity EnsemblGenomesN/AIEA
GO:0016787GO-mf hydrolase activity EnsemblGenomesN/AIEA
KOG0176 KOG 20S proteasome, regulatory subunit alpha type PSMA5/PUP2 JGI N/AIEA
PTHR11599Panther PROTEASOME SUBUNIT ALPHA/BETA JGI N/AIEA
PTHR11599:SF14Panther PROTEASOME SUBUNIT ALPHA TYPE-5 JGI N/AIEA
PF00227PFAM Proteasome subunit JGI N/AIEA
PF10584PFAM Proteasome subunit A N-terminal signature JGI N/AIEA

Proteins Associated with Glyma.10g014300
LocusGene SymbolProtein Name
PAE1 20S proteasome subunit

Expression Patterns of Glyma.10g014300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.10g014300 not represented in the dataset
Glyma.10g014300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.10g014300 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma10g01760 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.10g014300
>Glyma.10g014300.1 sequence-type=CDS polypeptide=Glyma.10g014300.1.p locus=Glyma.10g014300 ID=Glyma.10g014300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTTTCTCACAAGGACTGAGTATGACCGAGGAGTCAACACCTTTTCTCCCGAAGGCCGTTTGTTTCAGGTTGAGTATGCAATCGAAGCCATCAAGCTGGGATCAACTGCGATTGGGTTGAAGACCAAAGAAGGAGTTGTCCTTGCAGTTGAAAAGCGCATCACATCGCCGCTCCTGGAGCCTAGTAGTGTTGAGAAAATTATGGAAATTGATGAGCACATCGGTTGTGCAATGAGTGGGTTGATTGCAGATGCTCGAACACTTGTTGAGCATGCACGGGTGGAAACTCAGAATCACAGGTTCTCCTATGGTGAGCCTATGACTGTTGAGTCCACCACCCAAGCTCTTTGTGATCTAGCCTTGCGTTTTGGTGAAGGTGATGAAGAGTCCATGTCCCGACCATTTGGAGTATCTCTCCTCATTGCTGGTCATGATGAGAATGGACCTAGCTTATACTACACTGATCCATCTGGCACATTTTGGCAATGCAATGGCAAAGCTATTGGTTCAGGGTCAGAAGGTGCAGACAGTTCTCTACAAGAACAATTCAGCAAGGACCTAACCCTTCAAGAAGCCGAGACTATTGCTTTATCCATTTTGAAGCAAGTTATGGAAGAAAAGGTCACTCCCAACAACGTTGACATTGCCAAGGTGGCTCCAACGTATCATCTTTATACACCGTCTGAGGTGGAAGCTGTGATAAGTCGTCTATGA
Predicted protein sequences of Glyma.10g014300
>Glyma.10g014300.1.p sequence-type=predicted peptide transcript=Glyma.10g014300.1 locus=Glyma.10g014300 ID=Glyma.10g014300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MFLTRTEYDRGVNTFSPEGRLFQVEYAIEAIKLGSTAIGLKTKEGVVLAVEKRITSPLLEPSSVEKIMEIDEHIGCAMSGLIADARTLVEHARVETQNHRFSYGEPMTVESTTQALCDLALRFGEGDEESMSRPFGVSLLIAGHDENGPSLYYTDPSGTFWQCNGKAIGSGSEGADSSLQEQFSKDLTLQEAETIALSILKQVMEEKVTPNNVDIAKVAPTYHLYTPSEVEAVISRL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo