SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.10G059500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.10G059500): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.10G059500

Feature Type:gene_model
Chromosome:Gm10
Start:5497547
stop:5503529
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G21170.1AT triosephosphate isomerase JGI N/AIEA
GO:0006094GO-bp gluconeogenesis EnsemblGenomesN/AIEA
GO:0006096GO-bp glycolytic process EnsemblGenomesN/AIEA
GO:0008152GO-bp metabolic process EnsemblGenomesN/AIEA
GO:0008152GO-bp metabolic process JGI N/AIEA
GO:0019563GO-bp glycerol catabolic process EnsemblGenomesN/AIEA
GO:0046166GO-bp glyceraldehyde-3-phosphate biosynthetic process EnsemblGenomesN/AIEA
GO:0005829GO-cc cytosol EnsemblGenomesN/AIEA
GO:0003824GO-mf catalytic activity EnsemblGenomesN/AIEA
GO:0004807GO-mf triose-phosphate isomerase activity EnsemblGenomesN/AIEA
GO:0004807GO-mf triose-phosphate isomerase activity JGI N/AIEA
KOG1643 KOG Triosephosphate isomerase JGI N/AIEA
PTHR21139Panther TRIOSEPHOSPHATE ISOMERASE JGI N/AIEA
PF00121PFAM Triosephosphate isomerase JGI N/AIEA
CALVIN-PWYSoyCyc9 Calvin-Benson-Bassham cycle Plant Metabolic Network ISS
GLUCONEO-PWYSoyCyc9 gluconeogenesis I Plant Metabolic Network ISS
GLYCOLYSISSoyCyc9 glycolysis I (from glucose 6-phosphate) Plant Metabolic Network ISS
PHOTOALL-PWYSoyCyc9 oxygenic photosynthesis Plant Metabolic Network ISS
PWY-1042SoyCyc9 glycolysis IV (plant cytosol) Plant Metabolic Network ISS
PWY-5464SoyCyc9 superpathway of cytosolic glycolysis (plants), pyruvate dehydrogenase and TCA cycle Plant Metabolic Network ISS
PWY-5484SoyCyc9 glycolysis II (from fructose 6-phosphate) Plant Metabolic Network ISS
PWY-7345SoyCyc9 superpathway of anaerobic sucrose degradation Plant Metabolic Network ISS
GN7V-44268SoyCyc9-rxn triose-phosphate isomerase Plant Metabolic Network ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.10G059500 not represented in the dataset

Glyma.10G059500 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.



View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


ParalogEvidenceComments
Glyma.13g146200 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g059500 Wm82.a4.v1ISS As supplied by JGI
Glyma10g06740 Wm82.a1.v1.1IGC As supplied by JGI


>Glyma.10g059500.1 sequence-type=CDS polypeptide=Glyma.10g059500.1.p locus=Glyma.10g059500 ID=Glyma.10g059500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCAGCAACCTCAACATCCCTCTTCTCCTCAAATCTCCATTCTCTCAACTCACAACCTTTCTCTTCCTCACTCTCCTTCTTCCGAAATGTCCATTCCACCCTCTCTTTCCCTTCTTCTAAACCCTCCCGTGGCGTTGTAGCCATGGCTGGCTCTGGCAAGTTCTTTGTTGGTGGCAATTGGAAGTGTAATGGGACCAAAGACTCCATCAGAAAGCTTGTCTCTGACTTGAACAGTGCAACATTGGAGTCTGATGTTGATGTTGTTGTTGCACCTCCTTTTGTGTACATCGATCAGGTGAAAAACTCAATTACAGATAGGATTGAAATTTCTGCCCAGAATTCTTGGGTGGGAAAAGGTGGGGCTTTCACGGGAGAAATCAGTGTGGAGCAACTAAAAGACCTTGGCTGCAAGTGGGTTATTCTTGGACATTCTGAGCGAAGACATGTAATTGGAGAAAATGATGAGTTTATAGGGAAGAAGGCTGTCTATGCTTTGAGTGAGGGTCTGGGTGTGATAGCATGTATTGGGGAACTGTTACAAGAAAGAGAAGCTGGGAAAACTTTCGATGTTTGTTTTCAGCAATTGAAGGCTTTTGCAGATGTAGTGCCAAGTTGGGATAATATAGTTATTGCATATGAGCCTGTATGGGCAATTGGAACTGGCAAAGTGGCCACACCCGAGCAAGCCCAGGAAGTCCATGCAGCTGTTCGTGACTGGCTTAAGAAGAATGTATCGGCTGAAGTTTCATCTAAAACGCGAATTATTTATGGAGGGTCTGTAAATGCGAGCAACAGTGCTGAGCTCGCGAAGCAAGAAGATATTGATGGATTTCTTGTTGGTGGTGCTTCATTAAAGGGTCCGGAGTTTGCTACCATTATCAATTCAGTCACATCCAAGAAAGTTGCGGCTTAA

>Glyma.10g059500.1.p sequence-type=predicted peptide transcript=Glyma.10g059500.1 locus=Glyma.10g059500 ID=Glyma.10g059500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MAATSTSLFSSNLHSLNSQPFSSSLSFFRNVHSTLSFPSSKPSRGVVAMAGSGKFFVGGNWKCNGTKDSIRKLVSDLNSATLESDVDVVVAPPFVYIDQVKNSITDRIEISAQNSWVGKGGAFTGEISVEQLKDLGCKWVILGHSERRHVIGENDEFIGKKAVYALSEGLGVIACIGELLQEREAGKTFDVCFQQLKAFADVVPSWDNIVIAYEPVWAIGTGKVATPEQAQEVHAAVRDWLKKNVSAEVSSKTRIIYGGSVNASNSAELAKQEDIDGFLVGGASLKGPEFATIINSVTSKKVAA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo