Glyma.09g192900

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.09g192900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.09g192900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.09g192900

Feature Type:	gene_model
Chromosome:	Gm09
Start:	41744439
stop:	41746229
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.09g192900

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G22320.1	AT	Eukaryotic rpb5 RNA polymerase subunit family protein	JGI	N/A	IEA
GO:0006351	GO-bp	transcription, DNA-templated	EnsemblGenomes	N/A	IEA
GO:0006351	GO-bp	transcription, DNA-templated	JGI	N/A	IEA
GO:0006360	GO-bp	transcription by RNA polymerase I	EnsemblGenomes	N/A	IEA
GO:0006366	GO-bp	transcription by RNA polymerase II	EnsemblGenomes	N/A	IEA
GO:0006383	GO-bp	transcription by RNA polymerase III	EnsemblGenomes	N/A	IEA
GO:0005634	GO-cc	nucleus	EnsemblGenomes	N/A	IEA
GO:0005634	GO-cc	nucleus	JGI	N/A	IEA
GO:0005665	GO-cc	DNA-directed RNA polymerase II, core complex	EnsemblGenomes	N/A	IEA
GO:0005666	GO-cc	DNA-directed RNA polymerase III complex	EnsemblGenomes	N/A	IEA
GO:0005736	GO-cc	DNA-directed RNA polymerase I complex	EnsemblGenomes	N/A	IEA
GO:0001054	GO-mf	RNA polymerase I activity	EnsemblGenomes	N/A	IEA
GO:0001055	GO-mf	RNA polymerase II activity	EnsemblGenomes	N/A	IEA
GO:0001056	GO-mf	RNA polymerase III activity	EnsemblGenomes	N/A	IEA
GO:0003677	GO-mf	DNA binding	EnsemblGenomes	N/A	IEA
GO:0003677	GO-mf	DNA binding	JGI	N/A	IEA
GO:0003899	GO-mf	DNA-directed 5'-3' RNA polymerase activity	EnsemblGenomes	N/A	IEA
GO:0003899	GO-mf	DNA-directed RNA polymerase activity	JGI	N/A	IEA
KOG3218	KOG	RNA polymerase, 25-kDa subunit (common to polymerases I, II and III)	JGI	N/A	IEA
PTHR10535	Panther	DNA-DIRECTED RNA POLYMERASES I, II, AND III SUBUNIT RPABC1	JGI	N/A	IEA
PF01191	PFAM	RNA polymerase Rpb5, C-terminal domain	JGI	N/A	IEA
PF03871	PFAM	RNA polymerase Rpb5, N-terminal domain	JGI	N/A	IEA

Expression Patterns of Glyma.09g192900

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.09g192900 not represented in the dataset	Glyma.09g192900 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.09g192900

Paralog	Evidence	Comments
Glyma.07g084000	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.09g192900 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma09g32550	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.09g192900

Limit To All Plant Sequences

>Glyma.09g192900.1 sequence-type=CDS polypeptide=Glyma.09g192900.1.p locus=Glyma.09g192900 ID=Glyma.09g192900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGTGCTTTCGGAGGAGGAAATCGGTCGTCTATACCGAATAAGGAAGACGGTGATGCAGATGCTGAGGGACAGAAATTTTCTGGTTGGTGACTTCGAGATCAACATGTCCAAGCACGAGTTCAAGTCCAAGTACGGCGAACACATGAAGCGCGAGGACCTCGTCATCAACAAATCCAAGAAGGACAACTCCGGCGACCAGATCTACGTTTTCTTCCCCGACGAACCCAAGGTCGGCGTCAAGACCATGAAGACCTACACCAACCGCATGAACTCCGAAAACGTCTACAGAGCCATCCTCGTCACCCAGACCAACCTCACCCCCTTCGCCAGAACCTGCATCAGCGAAATCTCCTCCAAATTCCACTTAGAAGTCTTCCAGGAGGCGGAGCTGCTGGTTAACATTAAAGAGCACGAGCTTGTTCCCGAACATCAGGTTCTCACTGACGCCGAGAAGAAAACCTTGCTTGAGAGATACACCGTCAAGGAAACTCAGTTACCTAGGATTCAGGTCACAGATCCTGTTGCGAGATATTATGGATTGAAGCGTGGACAAGTTGTCAAGATTATCCGGCCAAGTGAAACTGCTGGCAGATATGTTACGTACCGATTTGTTGTATAG

Predicted protein sequences of Glyma.09g192900

Limit To All Plant Sequences

>Glyma.09g192900.1.p sequence-type=predicted peptide transcript=Glyma.09g192900.1 locus=Glyma.09g192900 ID=Glyma.09g192900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MVLSEEEIGRLYRIRKTVMQMLRDRNFLVGDFEINMSKHEFKSKYGEHMKREDLVINKSKKDNSGDQIYVFFPDEPKVGVKTMKTYTNRMNSENVYRAILVTQTNLTPFARTCISEISSKFHLEVFQEAELLVNIKEHELVPEHQVLTDAEKKTLLERYTVKETQLPRIQVTDPVARYYGLKRGQVVKIIRPSETAGRYVTYRFVV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain