Report for Sequence Feature Glyma.09g171300
| Feature Type: | gene_model |
| Chromosome: | Gm09 |
| Start: | 40540528 |
| stop: | 40540617 |
| Source: | JGI |
| Version: | Wm82.a4.v1 |
| High confidence: | yes |
| 
|
Annotations for Glyma.09g171300
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
| GO:0017004 | GO-bp |
cytochrome complex assembly |
JGI | N/A | IEA |
| GO:0009512 | GO-cc |
cytochrome b6f complex |
JGI | N/A | IEA |
| GO:0045158 | GO-mf |
electron transporter, transferring electrons within cytochrome b6/f complex of photosystem II activity |
JGI | N/A | IEA |
| PTHR35773 | PantherFam |
FAMILY NOT NAMED |
JGI | N/A | IEA |
| PF03742 | Pfam |
PetN |
JGI | N/A | IEA |
Gene model name correspondences to Glyma.09g171300 Gene Call Version Wm82.a4.v1
| Corresponding Name | Annotation Version | Evidence | Comments |
Coding sequences of Glyma.09g171300
>Glyma.09g171300.1 sequence-type=CDS polypeptide=Glyma.09g171300.1.p locus=Glyma.09g171300 id=Glyma.09g171300.1.Wm82.a4.v1 annot-version=Wm82.a4.v1
ATGGATATAATAAGTCTTGCTTGGGCTACTTTAATGGTAGCTTTTTCATTTTCTCATTCCCTCGTAGTATGGGGAAGAAGTGGACTATAG
Predicted protein sequences of Glyma.09g171300
>Glyma.09g171300.1.p sequence-type=predicted peptide transcript=Glyma.09g171300.1 locus=Glyma.09g171300 id=Glyma.09g171300.1.p.Wm82.a4.v1 annot-version=Wm82.a4.v1
MDIISLAWATLMVAFSFSHSLVVWGRSGL*