Glyma.09g098900

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.09g098900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.09g098900): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.09g098900

Feature Type:	gene_model
Chromosome:	Gm09
Start:	17492642
stop:	17494902
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.09g098900

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G58070.1	AT	temperature-induced lipocalin	JGI	N/A	IEA
GO:0005215	GO-mf	transporter activity	EnsemblGenomes	N/A	IEA
KOG4824	KOG	Apolipoprotein D/Lipocalin	JGI	N/A	IEA
PTHR10612	Panther	APOLIPOPROTEIN D	JGI	N/A	IEA
PTHR10612:SF7	Panther	APOLIPOPROTEIN D	JGI	N/A	IEA
PF08212	PFAM	Lipocalin-like domain	JGI	N/A	IEA
CAROTENOID-PWY	SoyCyc9	superpathway of carotenoid biosynthesis in plants	Plant Metabolic Network		ISS
PWY-5945	SoyCyc9	violaxanthin, antheraxanthin and zeaxanthin interconversion	Plant Metabolic Network		ISS
GN7V-68426	SoyCyc9-rxn	Zeaxanthin epoxidase	Plant Metabolic Network		ISS

Proteins Associated with Glyma.09g098900

Locus	Gene Symbol	Protein Name
	TIL	temperature-induced lipocalin

Expression Patterns of Glyma.09g098900

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.09g098900 not represented in the dataset	Glyma.09g098900 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Gene model name correspondences to Glyma.09g098900 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma09g14870	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.09g098900

Limit To All Plant Sequences

>Glyma.09g098900.1 sequence-type=CDS polypeptide=Glyma.09g098900.1.p locus=Glyma.09g098900 ID=Glyma.09g098900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCCAACAAAGAGATGGAAGTTGTGAAGGGTTTGGATTTGCAAAGGTACATGGGGCGTTGGTATGAGATAGCCTCTTTCCCTTCAAGGAATCAGCCCAAGGATGGTGAGAACACCAGAGCCACATACACTCTTAGGAATGATGGTACTGTGCAAGTGCTCAACGAGACTTGGAGTAATGGCAAGAGAGGGTACATACAAGGAACTGCTTATAAGGTTGACCCCAAAAGTGATGAGGCCAAGTTCAAGGTCAAGTTTTATATTCCTCCCTTCTTGCCCATTATACCTATAAATGGGGACTACTGGGTTTTGTTCACTGACGATGAATATCAGTATGCTTTGATTGGCCAACCAAGCAGGAATTACCTTTGGATATTAAGCAGGAAACCCCATCTGGATGATGAGATCTACAACGAGCTTGTTCAGAGAGCTAAGAATGTAGGATATGATGTGAGCAAACTCCGCAAGACCCCACAGAGCGATCCTCCACCAGAGGAAGAAGGCCCTGATGACACCAAAGGCATTTGGTGGCTCAAATCCATTTTTGGAAAATAG

Predicted protein sequences of Glyma.09g098900

Limit To All Plant Sequences

>Glyma.09g098900.1.p sequence-type=predicted peptide transcript=Glyma.09g098900.1 locus=Glyma.09g098900 ID=Glyma.09g098900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MANKEMEVVKGLDLQRYMGRWYEIASFPSRNQPKDGENTRATYTLRNDGTVQVLNETWSNGKRGYIQGTAYKVDPKSDEAKFKVKFYIPPFLPIIPINGDYWVLFTDDEYQYALIGQPSRNYLWILSRKPHLDDEIYNELVQRAKNVGYDVSKLRKTPQSDPPPEEEGPDDTKGIWWLKSIFGK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain