SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.09g061000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.09g061000): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.09g061000

Feature Type:gene_model
Chromosome:Gm09
Start:5717787
stop:5720484
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.09g061000
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G13580.1AT Ribosomal protein L30/L7 family protein JGI N/AIEA
GO:0000463GO-bp maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) EnsemblGenomesN/AIEA
GO:0002181GO-bp cytoplasmic translation EnsemblGenomesN/AIEA
GO:0022625GO-cc cytosolic large ribosomal subunit EnsemblGenomesN/AIEA
GO:0003723GO-mf RNA binding EnsemblGenomesN/AIEA
GO:0003735GO-mf structural constituent of ribosome EnsemblGenomesN/AIEA
KOG3184 KOG 60S ribosomal protein L7 JGI N/AIEA
PTHR11524Panther 60S RIBOSOMAL PROTEIN L7 JGI N/AIEA
PF00327PFAM Ribosomal protein L30p/L7e JGI N/AIEA
PF08079PFAM Ribosomal L30 N-terminal domain JGI N/AIEA

Expression Patterns of Glyma.09g061000
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.09g061000 not represented in the dataset
Glyma.09g061000 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.09g061000
ParalogEvidenceComments
Glyma.15g167400 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.09g061000 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma09g06860 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.09g061000
>Glyma.09g061000.1 sequence-type=CDS polypeptide=Glyma.09g061000.1.p locus=Glyma.09g061000 ID=Glyma.09g061000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGGCGAAGCGAAGGCGTTGGTTCCGGAATCGGTGGTGAAGAAGGAGAAGAGGAACGAGGAGTGGGCTTTGGAGAAGAAGCAGGAACTCGATGCCGCAAAGAAAAAGAGGTTCGAAACGCGGAAGCTGATTTTTAACAGAGCCAAACAGTACTCAAAGGAATACGACGAGCAGCAAAAGGAGTTGATTAGGTTGAAGCGTGAAGCCAAGCTTAAGGGAGGGTTTTATGTTGAACCTGAAGCTAAGCTCTTGTTCATCATCAGGATCCGTGGTATCAATGCCATGGATCCTAAAACAAGGAAGATTCTGCAGCTTCTGCGTTTGAGACAGATTTTTAATGGCGTCTTTCTTAAAGTGAACAAAGCTACCGTGAATATGCTGCATAGGGTAGAGCCTTATGTTACCTATGGGTACCCTAATTTGAAGAGTGTAAAAGAATTGATCTACAAGAGGGGCTATGGAAAAGTTAACAAGCAGAGAATTGCCTTAAATGACAACTCTATTGTTGAACAGACTTTGGGGAAGCATGGGATCATTTGCGTTGAAGATCTGATCCATGAGATATTGACTGTTGGACCTCATTTCAAGGAGGCCAACAATTTTCTGTGGCCTTTTAAGCTCAAAGCTCCCCTTGGTGGTTTGGAGAAGAAAAGAAATCATTATGTTGAAGGAGGTGATGCTGGCAACAGGGAGGATTACATAAATGAGCTTATTAGAAGGATGAATTAG
Predicted protein sequences of Glyma.09g061000
>Glyma.09g061000.1.p sequence-type=predicted peptide transcript=Glyma.09g061000.1 locus=Glyma.09g061000 ID=Glyma.09g061000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MGEAKALVPESVVKKEKRNEEWALEKKQELDAAKKKRFETRKLIFNRAKQYSKEYDEQQKELIRLKREAKLKGGFYVEPEAKLLFIIRIRGINAMDPKTRKILQLLRLRQIFNGVFLKVNKATVNMLHRVEPYVTYGYPNLKSVKELIYKRGYGKVNKQRIALNDNSIVEQTLGKHGIICVEDLIHEILTVGPHFKEANNFLWPFKLKAPLGGLEKKRNHYVEGGDAGNREDYINELIRRMN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo