Glyma.09G014100

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.09G014100

Feature Type:	gene_model
Chromosome:	Gm09
Start:	1058153
stop:	1059688
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.09G014100

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G14540.1	AT	nuclear factor Y, subunit B3	JGI	N/A	IEA
GO:0006355	GO-bp	regulation of transcription, DNA-templated	EnsemblGenomes	N/A	IEA
GO:0005622	GO-cc	intracellular	JGI	N/A	IEA
GO:0005634	GO-cc	nucleus	EnsemblGenomes	N/A	IEA
GO:0003677	GO-mf	DNA binding	JGI	N/A	IEA
GO:0043565	GO-mf	sequence-specific DNA binding	EnsemblGenomes	N/A	IEA
GO:0043565	GO-mf	sequence-specific DNA binding	JGI	N/A	IEA
GO:0046982	GO-mf	protein heterodimerization activity	EnsemblGenomes	N/A	IEA
KOG0869	KOG	CCAAT-binding factor, subunit A (HAP3)	JGI	N/A	IEA
PTHR11064	Panther	CCAAT-BINDING TRANSCRIPTION FACTOR-RELATED	JGI	N/A	IEA
PTHR11064:SF9	Panther	NUCLEAR FACTOR Y-BOX B	JGI	N/A	IEA
PF00808	PFAM	Histone-like transcription factor (CBF/NF-Y) and archaeal histone	JGI	N/A	IEA

Proteins Associated with Glyma.09G014100

Locus	Gene Symbol	Protein Name
	NF-YB3a	Nuclear Transcripiton Factor Y Subunit Beta 3 gene a

Expression Patterns of Glyma.09G014100

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.09G014100

Paralog	Evidence	Comments
Glyma.15g118800	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.09G014100 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g014100	Wm82.a4.v1	ISS	As supplied by JGI
Glyma09g01650	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.09G014100

Limit To All Plant Sequences

>Glyma.09g014100.1 sequence-type=CDS polypeptide=Glyma.09g014100.1.p locus=Glyma.09g014100 ID=Glyma.09g014100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCTGAGTCCGACAACGAGTCAGGAGGTCACACGGGGAACGCGAGCGGGAGCAACGAGTTGTCCGGTTGCAGGGAGCAAGACAGGTTCCTCCCAATAGCAAACGTGAGCAGGATCATGAAGAAGGCGTTGCCGGCGAACGCGAAGATATCGAAGGAGGCGAAGGAGACGGTGCAGGAGTGCGTGTCGGAGTTCATCAGCTTCATAACAGGAGAGGCTTCCGATAAGTGCCAGAAGGAGAAGAGGAAGACGATCAACGGCGACGATCTTCTCTGGGCCATGACTACCCTGGGCTTCGAGGACTACGTGGATCCTCTCAAGATTTACCTGCACAAGTATAGGGAGATGGAGGGGGAGAAAACCGCTATGATGGGAAGGCCACATGAGAGGGATGAGGGTTATGGCCATGGCCATGGTCATGCAACTCCTATGATGACGATGATGATGGGGCATCAGCCCCAGCACCAGCACCAGCACCAGCACCAGGGACACGTGTATGGATCTGGATCAGCATCTTCTGCAAGAACTAGATAG

Predicted protein sequences of Glyma.09G014100

Limit To All Plant Sequences

>Glyma.09g014100.1.p sequence-type=predicted peptide transcript=Glyma.09g014100.1 locus=Glyma.09g014100 ID=Glyma.09g014100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MAESDNESGGHTGNASGSNELSGCREQDRFLPIANVSRIMKKALPANAKISKEAKETVQECVSEFISFITGEASDKCQKEKRKTINGDDLLWAMTTLGFEDYVDPLKIYLHKYREMEGEKTAMMGRPHERDEGYGHGHGHATPMMTMMMGHQPQHQHQHQHQGHVYGSGSASSARTR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain