Glyma.08g198300

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.08g198300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.08g198300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.08g198300

Feature Type:	gene_model
Chromosome:	Gm08
Start:	16001961
stop:	16003430
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.08g198300

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G35790.1	AT	glucose-6-phosphate dehydrogenase 1	JGI	N/A	IEA
GO:0006006	GO-bp	glucose metabolic process	EnsemblGenomes	N/A	IEA
GO:0006006	GO-bp	glucose metabolic process	JGI	N/A	IEA
GO:0055114	GO-bp	oxidation-reduction process	EnsemblGenomes	N/A	IEA
GO:0055114	GO-bp	oxidation-reduction process	JGI	N/A	IEA
GO:0004345	GO-mf	glucose-6-phosphate dehydrogenase activity	EnsemblGenomes	N/A	IEA
GO:0004345	GO-mf	glucose-6-phosphate dehydrogenase activity	JGI	N/A	IEA
GO:0050661	GO-mf	NADP binding	EnsemblGenomes	N/A	IEA
GO:0050661	GO-mf	NADP binding	JGI	N/A	IEA
PTHR23429	Panther	GLUCOSE-6-PHOSPHATE 1-DEHYDROGENASE (G6PD)	JGI	N/A	IEA
PF00479	PFAM	Glucose-6-phosphate dehydrogenase, NAD binding domain	JGI	N/A	IEA
PF02781	PFAM	Glucose-6-phosphate dehydrogenase, C-terminal domain	JGI	N/A	IEA
OXIDATIVEPENT-PWY	SoyCyc9	pentose phosphate pathway (oxidative branch) I	Plant Metabolic Network		ISS
PENTOSE-P-PWY	SoyCyc9	pentose phosphate pathway	Plant Metabolic Network		ISS
GN7V-46335	SoyCyc9-rxn	glucose-6-phosphate dehydrogenase	Plant Metabolic Network		ISS

Expression Patterns of Glyma.08g198300

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.08g198300 not represented in the dataset	Glyma.08g198300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Gene model name correspondences to Glyma.08g198300 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma08g21180	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.08g198300

Limit To All Plant Sequences

>Glyma.08g198300.1 sequence-type=CDS polypeptide=Glyma.08g198300.1.p locus=Glyma.08g198300 ID=Glyma.08g198300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGATCAGTTCTTAAAAAGATGCTTTTACCATTCTGGTCAATACAACTCCGAGGACCACTTTTCTGAATTGGGTAGCAAGCTGAGAGAGAAAGAGGGTGGAAAGCTATCAAACAGATTGTTTTATTTGTCAATACCTCCAAACATATTTGTGGATGTGGTGAGATGCGCTAGTCTTAAAGCTTCTTCAAAAGATGGATGGACAAGGGTTATTGTTGAAAAGCCATTTGGTCGTGACTCAGAATCATCTAGTGAGCTAACAAAGAGTTTGAAGCAGCACCTCACTGAAGACCAAATATTCAGGATTGACCATTACTTGGGTAAGGAGCTCGTGGAGAATCTGTCAGTGCTTCGCTTTTCAAATCTTGATTTTGAGCCTCTATGGTCCCGGAATTACATTCGCAATGTGCAGATAATATTTTCTGAAGATTTTGGAACTGAAGGAAGAGGAGGTGATTTTGATCACTATGGAATCATTCGTGATATAATGCAAAATCATCTTCTGCAAATACTAGCATTGTTTGCAATGGAAACACCAGTCAGCTTGGCTGCTGAGGACATCAGAAATGAAAAGGTTATGAGATCAATGAGACCACTCGAACTTGAAAATGTTGTTGATAATAAGTTTTAA

Predicted protein sequences of Glyma.08g198300

Limit To All Plant Sequences

>Glyma.08g198300.1.p sequence-type=predicted peptide transcript=Glyma.08g198300.1 locus=Glyma.08g198300 ID=Glyma.08g198300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MDQFLKRCFYHSGQYNSEDHFSELGSKLREKEGGKLSNRLFYLSIPPNIFVDVVRCASLKASSKDGWTRVIVEKPFGRDSESSSELTKSLKQHLTEDQIFRIDHYLGKELVENLSVLRFSNLDFEPLWSRNYIRNVQIIFSEDFGTEGRGGDFDHYGIIRDIMQNHLLQILALFAMETPVSLAAEDIRNEKVMRSMRPLELENVVDNKF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain