Glyma.07g204000

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.07g204000

Feature Type:	gene_model
Chromosome:	Gm07
Start:	37322476
stop:	37327503
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.07g204000

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G33990.1	AT	IQ-domain 9	JGI	N/A	IEA
GO:0005515	GO-mf	protein binding	EnsemblGenomes	N/A	IEA
GO:0005515	GO-mf	protein binding	JGI	N/A	IEA
PTHR10699	Panther	NEUROMODULIN	JGI	N/A	IEA
PTHR10699:SF9	Panther		JGI	N/A	IEA
PF00612	PFAM	IQ calmodulin-binding motif	JGI	N/A	IEA

Proteins Associated with Glyma.07g204000

Locus	Gene Symbol	Protein Name
	IQD25	protein IQ-DOMAIN 25

Expression Patterns of Glyma.07g204000

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.07g204000 not represented in the dataset	Glyma.07g204000 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.07g204000

Paralog	Evidence	Comments
Glyma.13g172000	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.07g204000 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma07g32531	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.07g204000

Limit To All Plant Sequences

>Glyma.07g204000.1 sequence-type=CDS polypeptide=Glyma.07g204000.1.p locus=Glyma.07g204000 ID=Glyma.07g204000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGGTTCAGGTGATTGGTTTAAGACAATAATTAGCTCAAGAAAATCAAAAGAAGGCACATCAAAGAAAGTAAAGACTAAGATTTATACAAGAAAAAAGTCCAATGGTTTAGCAAATGGAATCAAAAGCAAAAATCTAGAGTCAGATGGGGTATCAGTTGAAACTATTGCTGCAACAAGGATCCAAACAGCATTCCGAGCTTATAAGGCTAGAAAATATTTACACCGCTTGAGAGGATTCACAAAATTGAAGATCCAGACTCAAGGTTCCTCTGTTCAAAAACAAGCCGCCACAACTATAACTTATCTTCATTCATGGAGCAAGATACAGGCTGAGATTAGAGCTCGCCGAATATGTATGGTTACAGAAGACAGAATCAGGCGGAAGATAATACATTCTCAACTAAAACTTGAGTCCAAGATTCATGACCTGGAGGTGGAATGGTGTGGTGGTTCTGAAACCAAGAAGGAAATCCTTGCAAGGTTACATCACAGAGAAGAAGCTGCGGTCAAGCGGGAAAGAACCATGGCATATGCCTTCTCTCATCAGTGGAGGGCCAACTCTAGCCAAGGGCTAGGAAATTATGACCTTGGCAAAGCTAGTTGGAGTTGGAGCTGGAAGGATCGATGGATTGCTACGCGCCCTTGGGAAAGCCGTGTGCCAAGTGTAACCATTAGCCCCCCTAAAGATCAAAATAAGAAGCCGAACAAAGTTAAGAAGGATAAGAATTCATCAACATCAAAAAAACCAATTTCAGTTAAAACTCCTTCAGCTAATGCTAAAGGGACTAAATCCTTAGGTAATGCAAAAGGGACTACAAAAGCTAGAAGAAGATTGTCTTACCCTGCTGCCACAGAAAAAAGCAGTGCCTGA

Predicted protein sequences of Glyma.07g204000

Limit To All Plant Sequences

>Glyma.07g204000.1.p sequence-type=predicted peptide transcript=Glyma.07g204000.1 locus=Glyma.07g204000 ID=Glyma.07g204000.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MGSGDWFKTIISSRKSKEGTSKKVKTKIYTRKKSNGLANGIKSKNLESDGVSVETIAATRIQTAFRAYKARKYLHRLRGFTKLKIQTQGSSVQKQAATTITYLHSWSKIQAEIRARRICMVTEDRIRRKIIHSQLKLESKIHDLEVEWCGGSETKKEILARLHHREEAAVKRERTMAYAFSHQWRANSSQGLGNYDLGKASWSWSWKDRWIATRPWESRVPSVTISPPKDQNKKPNKVKKDKNSSTSKKPISVKTPSANAKGTKSLGNAKGTTKARRRLSYPAATEKSSA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain