SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.07g029300

Feature Type:gene_model
Chromosome:Gm07
Start:2350425
stop:2353398
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.07g029300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03500.1AT Mediator complex, subunit Med7 JGI N/AIEA
GO:0006351GO-bp transcription, DNA-templated EnsemblGenomesN/AIEA
GO:0006355GO-bp regulation of transcription, DNA-templated EnsemblGenomesN/AIEA
GO:0006357GO-bp regulation of transcription by RNA polymerase II EnsemblGenomesN/AIEA
GO:0006357GO-bp regulation of transcription from RNA polymerase II promoter JGI N/AIEA
GO:0005634GO-cc nucleus EnsemblGenomesN/AIEA
GO:0016592GO-cc mediator complex EnsemblGenomesN/AIEA
GO:0016592GO-cc mediator complex JGI N/AIEA
GO:0070847GO-cc core mediator complex EnsemblGenomesN/AIEA
GO:0003712GO-mf transcription cofactor activity EnsemblGenomesN/AIEA
KOG0570 KOG Transcriptional coactivator JGI N/AIEA
PTHR21428Panther FAMILY NOT NAMED JGI N/AIEA
PTHR21428:SF6Panther JGI N/AIEA
PF05983PFAM MED7 protein JGI N/AIEA

Proteins Associated with Glyma.07g029300
LocusGene SymbolProtein Name
MED7-1 Mediator Complex 7 gene 1

Expression Patterns of Glyma.07g029300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.07g029300
ParalogEvidenceComments
Glyma.08g213500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.07g029300 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma07g03300 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.07g029300
>Glyma.07g029300.1 sequence-type=CDS polypeptide=Glyma.07g029300.1.p locus=Glyma.07g029300 ID=Glyma.07g029300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCGACGGCAACGTACCCTCCACCGCCACCTTATTACAGACTTTACAAAGATTACTTGCAAAACCCTAAGTCTGCTCCCGACCCTCCACCGCCTATTGAAGGCACTTATCTTTGTTTTGGAGCCAATTACACCACTAGTGATGTTCTACCAACCTTGGAAGAACAAGGGGTGCGCCAGCTCTATTCTAAGGGCCCTAATGTTGATTTCAAGAAGGAGCTGAGGTCACTCAACGGAGAGTTGCAACTACACGTTTTGGAGCTTGCTGATATTCTTATTGAGAGACCTTCACAGTATGCAAGGAGAGTAGAAGAAATTTCAACAGTATTCAAAAACTTACACCACCTTTTAAATTCATTGCGTCCTCATCAGGCGAGAGCAACATTGATTCATATTTTGGAACTTCAGATACAGCGCCGTAAACAAGCAGTGGAGGACATAAAGAGGAGGAGAGAAGAAGCACGAAGGCTCCTTAACGAGTCCTTGGCAACACTTGATGGCCATTAG
Predicted protein sequences of Glyma.07g029300
>Glyma.07g029300.1.p sequence-type=predicted peptide transcript=Glyma.07g029300.1 locus=Glyma.07g029300 ID=Glyma.07g029300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MATATYPPPPPYYRLYKDYLQNPKSAPDPPPPIEGTYLCFGANYTTSDVLPTLEEQGVRQLYSKGPNVDFKKELRSLNGELQLHVLELADILIERPSQYARRVEEISTVFKNLHHLLNSLRPHQARATLIHILELQIQRRKQAVEDIKRRREEARRLLNESLATLDGH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo