SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.07G177200

Feature Type:gene_model
Chromosome:Gm07
Start:33354118
stop:33354843
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.07G177200
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G69690.1AT TCP family transcription factor JGI N/AIEA
PF03634PFAM TCP family transcription factor JGI N/AIEA

Proteins Associated with Glyma.07G177200
LocusGene SymbolProtein Name
TCP9 Teosinte branched1 and cycloidea and proliferating cell factor family protein gene 9

Expression Patterns of Glyma.07G177200
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.07G177200 not represented in the dataset
Glyma.07G177200 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.07G177200 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma07g29015 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.07G177200
>Glyma.07g177200.1 sequence-type=CDS polypeptide=Glyma.07g177200.1.p locus=Glyma.07g177200 ID=Glyma.07g177200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGAGGGAGGCGAGGATCTCCACCACCATCACCACCACCACCACCGTCACAACAACTTCCCATTCCAGCTACTTGAGAAGAAAGAAGACCAAGAAACCGCCTCATGCTCCACCTCCTCCCTTTACCCTTCCCTAGAAATCTCCACGAAACCGAGCATGTCCAATTCCACCCGATCCAACCAGCTCGTTGTGGTGGCTATGGTGGAGGCTCCTAACAGCAAAAAGCCTCCGCCGAAGCGCACCTCGACCAAGGACCGACACATGAAGCTCACCCGCGAGCTGTGCCACAAGTCAGACGGTGAAACCATCGAGTGGCTCCTCCAGCAAGTGGAGCCTGCTGTGATCGCCGCCACCGGTACCGGCATCATCCCCGCCAACTTCACCTCCCTGAACATCTCCCTACGTAGTTCTGGCTCCTCCATAACCTTCTTCCCCGGTATAGCCTTTTCCTCCGACAATACCAACAACAACACATCAACACTTCTCAATTTCCAATCCAACACCCTCAACACCACCATGCTGCAGCAGCAGGCCATGCCGGAGCTTAGCGATGGCGGCGTGTCGTCTTCCTTAGACATTTTAGACACCATTGTCTAA
Predicted protein sequences of Glyma.07G177200
>Glyma.07g177200.1.p sequence-type=predicted peptide transcript=Glyma.07g177200.1 locus=Glyma.07g177200 ID=Glyma.07g177200.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MEGGEDLHHHHHHHHRHNNFPFQLLEKKEDQETASCSTSSLYPSLEISTKPSMSNSTRSNQLVVVAMVEAPNSKKPPPKRTSTKDRHMKLTRELCHKSDGETIEWLLQQVEPAVIAATGTGIIPANFTSLNISLRSSGSSITFFPGIAFSSDNTNNNTSTLLNFQSNTLNTTMLQQQAMPELSDGGVSSSLDILDTIV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo