SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma.06g269700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma.06g269700): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma.06g269700

Feature Type:gene_model
Chromosome:Gm06
Start:45848185
stop:45852587
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G54770.1AT thiazole biosynthetic enzyme, chloroplast (ARA6) (THI1) (THI4) JGI N/AIEA
GO:0006950GO-bp response to stress EnsemblGenomesN/AIEA
GO:0009228GO-bp thiamine biosynthetic process EnsemblGenomesN/AIEA
GO:0052837GO-bp thiazole biosynthetic process EnsemblGenomesN/AIEA
GO:0055114GO-bp oxidation-reduction process JGI N/AIEA
GO:0005829GO-cc cytosol EnsemblGenomesN/AIEA
GO:0009507GO-cc chloroplast EnsemblGenomesN/AIEA
GO:0009536GO-cc plastid EnsemblGenomesN/AIEA
GO:0009570GO-cc chloroplast stroma EnsemblGenomesN/AIEA
GO:0016020GO-cc membrane EnsemblGenomesN/AIEA
GO:0016021GO-cc integral component of membrane EnsemblGenomesN/AIEA
GO:0005506GO-mf iron ion binding EnsemblGenomesN/AIEA
GO:0016491GO-mf oxidoreductase activity JGI N/AIEA
GO:0046872GO-mf metal ion binding EnsemblGenomesN/AIEA
KOG2960 KOG Protein involved in thiamine biosynthesis and DNA damage tolerance JGI N/AIEA
PTHR10617Panther ELECTRON TRANSFER FLAVOPROTEIN-UBIQUINONE OXIDOREDUCTASE JGI N/AIEA
PTHR10617:SF54Panther JGI N/AIEA
PF01946PFAM Thi4 family JGI N/AIEA
PWY-6909SoyCyc9 thiazole biosynthesis III (eukaryotes) Plant Metabolic Network ISS
THISYNARA-PWYSoyCyc9 superpathway of thiamine diphosphate biosynthesis III (eukaryotes) Plant Metabolic Network ISS
GN7V-64912SoyCyc9-rxn Enzyme name not determined Plant Metabolic Network ISS

LocusGene SymbolProtein Name
SC-04 thiamin biosynthetic enzyme

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.06g269700 not represented in the dataset

Glyma.06g269700 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.



View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


ParalogEvidenceComments
Glyma.12g135000 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Corresponding NameAnnotation VersionEvidenceComments
Glyma06g42080 Wm82.a1.v1.1IGC As supplied by JGI


>Glyma.06g269700.1 sequence-type=CDS polypeptide=Glyma.06g269700.1.p locus=Glyma.06g269700 ID=Glyma.06g269700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCTTCTTCCACCATCACCTCCTCCTTCCTAACATCACCCCCTTCATCTCTCTTCAACAAATCATCATCCCCTTCCTTCCATGCCACCCCTACTCTCCGCCCCCTCGCGCCACGCGCCTCCATGTCCGCCTCAGCGCCGCCCTACGACTTCGGATCGTTCCGGTTCGATCCGATTAGAGAGTCGATTGTGTCGCGCGAGATGACCCGCAGGTACATGATCGACATGGTCACCCACGCCGACACCGACGTCGTCATCGTTGGCGCGGGCTCCGCGGGTCTCTCGTGCGCCTACGAGCTCTCCAAAAACCCCTCCATCAACATCGCCATTGTTGAGCAGTCCGTCAGCCCCGGCGGCGGCGCCTGGCTCGGCGGCCAACTCTTCTCCGCCATGGTAGTGCGTAAGCCCGCACACCTCTTCCTAGACGAGCTCAATGTGGAGTATGACGAACAAGACAACTATGTGGTGATCAAGCACGCAGCATTGTTCACATCCACCATCATGAGCAAGCTCTTGGCCAGGCCAAACGTGAAGCTCTTCAATGCCGTGGCGGCGGAGGACTTGATTGTGAAGAACGGGAGAGTTGGTGGGGTGGTGACCAACTGGGCCTTGGTTTCATTGAACCATGACACTCAATCCTGCATGGACCCCAATGTGATGGAGGCTAAGGTGGTGGTGAGTTCTTGTGGCCATGATGGACCCTTTGGAGCCACTGGGGTGAAGAGGCTCAAGAGCATTGGGTTAATTGATAGTGTGCCTGGGATGAAGGCACTTGACATGAACAAGGCTGAGGATGCCATTGTGAGGCTCACTAGGGAGGTTGTGCCTGGCATGATTGTTACTGGGATGGAAGTTGCTGAGATTGATGGTGCTCCAAGGATGGGTCCAACATTTGGAGCAATGATGATTTCAGGGCAAAAAGCAGCCCATCTGGCTTTGAGATCATTGGGACTTCCCAATGCTTTGGATTCAGTGGGAAACGTTCATCCTGAGCTTGTCCTAGCTGCTGCTGAATCCGCTGAAATTGCTGAGGCTTAA

>Glyma.06g269700.1.p sequence-type=predicted peptide transcript=Glyma.06g269700.1 locus=Glyma.06g269700 ID=Glyma.06g269700.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MASSTITSSFLTSPPSSLFNKSSSPSFHATPTLRPLAPRASMSASAPPYDFGSFRFDPIRESIVSREMTRRYMIDMVTHADTDVVIVGAGSAGLSCAYELSKNPSINIAIVEQSVSPGGGAWLGGQLFSAMVVRKPAHLFLDELNVEYDEQDNYVVIKHAALFTSTIMSKLLARPNVKLFNAVAAEDLIVKNGRVGGVVTNWALVSLNHDTQSCMDPNVMEAKVVVSSCGHDGPFGATGVKRLKSIGLIDSVPGMKALDMNKAEDAIVRLTREVVPGMIVTGMEVAEIDGAPRMGPTFGAMMISGQKAAHLALRSLGLPNALDSVGNVHPELVLAAAESAEIAEA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo