SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.06g055100

Feature Type:gene_model
Chromosome:Gm06
Start:4160509
stop:4166027
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.06g055100
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G12040.1AT Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein JGI N/AIEA
GO:0006807GO-bp nitrogen compound metabolic process EnsemblGenomesN/AIEA
GO:0006807GO-bp nitrogen compound metabolic process JGI N/AIEA
GO:0016740GO-mf transferase activity EnsemblGenomesN/AIEA
GO:0016746GO-mf transferase activity, transferring acyl groups EnsemblGenomesN/AIEA
GO:0016810GO-mf hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds EnsemblGenomesN/AIEA
GO:0016810GO-mf hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds JGI N/AIEA
KOG0806 KOG Carbon-nitrogen hydrolase JGI N/AIEA
PTHR23088Panther NITRILASE-RELATED JGI N/AIEA
PF00795PFAM Carbon-nitrogen hydrolase JGI N/AIEA
GN7V-47652SoyCyc9-rxn ω-amidase Plant Metabolic Network ISS

Expression Patterns of Glyma.06g055100
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.06g055100
ParalogEvidenceComments
Glyma.04g055000 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.
Glyma.20g016600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.06g055100 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma06g05770 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.06g055100
>Glyma.06g055100.1 sequence-type=CDS polypeptide=Glyma.06g055100.1.p locus=Glyma.06g055100 ID=Glyma.06g055100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGAAAGCATCCGCACTGCTTAACTTGAAATCTTTCACTCTCAGCCGCCATTCTCCCACTTCCAACTCCTTCTTCCCCCCCTTTCTTTGTCCATCCCACCCCCGCCACCGCCGAATCCACCACTCTCGAAATCCAATCATGTCTGCCACATCCGTCAACTCCGAACGAGCACGCGCCCCTCCCGCCATTCCCTTGCCCCCTCCCCCTCTCTCCAACTTCAAAATTGGCCTCTGTCAACTCTCCGTCAGCCCCGACAAAGACAGCAACATCGCCCACGCTCGCACCGCCATTCAGGATGCTGCATCAAAGGGCGCCCAGCTTGTTCTTTTGCCCGAAATTTGGAACAGTCCTTATTCCAACGATAGTTTTCCTGTCTACGCTGAGGATATTGACGCTGGTGCTTCTCCTTCCACTGCCATGCTATCTGAACTCTCTCGTCTCTTGAAAATCACCATAGTTGGTGGTTCCATTCCAGAACGCTCTGGAGGTCTCTTGTACAACACTTGCTGCGTCTTTGGCACCGACGGAAACCTACTAGCCAAGCACCGCAAGATACATCTTTTTGATATTGACATCCCTGGGAAGATTACTTTTATTGAATCAAAAACTCTTACTGCTGGGGAGACTCCGACAATTGTGGACACAGAGGTTGGACGCATTGGCATAGGCATCTGTTATGACATTCGATTTCCAGAACTAGCAATGATATATGCTGCTAGAGGTGCTCACTTACTCTGCTACCCTGGGGCATTTAACATGACAACTGGACCATTACATTGGGAGTTATTGCAGAGGGCAAGGGCTACAGATAATCAGTTATATGTGGCTACCTGTTCACCTGCCCGGGATACTGGATCTGGTTATGTGGCTTGGGGCCACTCCACTCTTGTTGGACCATTTGGAGAAGTTCTGGCTACTACAGAACATGAGGAGGCAATCATCATAGCAGAAATTGATTATTCAATATTGGAGCAGAGAAGGACAAATCTGCCTGTAACTAAGCAAAGGCGAGGTGATCTTTACCAGTTGGTGGATTTTCAGAGGCTGAATTCTCAGTGA
Predicted protein sequences of Glyma.06g055100
>Glyma.06g055100.1.p sequence-type=predicted peptide transcript=Glyma.06g055100.1 locus=Glyma.06g055100 ID=Glyma.06g055100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MKASALLNLKSFTLSRHSPTSNSFFPPFLCPSHPRHRRIHHSRNPIMSATSVNSERARAPPAIPLPPPPLSNFKIGLCQLSVSPDKDSNIAHARTAIQDAASKGAQLVLLPEIWNSPYSNDSFPVYAEDIDAGASPSTAMLSELSRLLKITIVGGSIPERSGGLLYNTCCVFGTDGNLLAKHRKIHLFDIDIPGKITFIESKTLTAGETPTIVDTEVGRIGIGICYDIRFPELAMIYAARGAHLLCYPGAFNMTTGPLHWELLQRARATDNQLYVATCSPARDTGSGYVAWGHSTLVGPFGEVLATTEHEEAIIIAEIDYSILEQRRTNLPVTKQRRGDLYQLVDFQRLNSQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo