|
A previous version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT2G02760.1 | AT | ubiquiting-conjugating enzyme 2 | JGI | N/A | IEA |
| GO:0000209 | GO-bp | protein polyubiquitination | EnsemblGenomes | N/A | IEA |
| GO:0006281 | GO-bp | DNA repair | EnsemblGenomes | N/A | IEA |
| GO:0016574 | GO-bp | histone ubiquitination | EnsemblGenomes | N/A | IEA |
| GO:0043161 | GO-bp | proteasome-mediated ubiquitin-dependent protein catabolic process | EnsemblGenomes | N/A | IEA |
| GO:0005737 | GO-cc | cytoplasm | EnsemblGenomes | N/A | IEA |
| GO:0000166 | GO-mf | nucleotide binding | EnsemblGenomes | N/A | IEA |
| GO:0005524 | GO-mf | ATP binding | EnsemblGenomes | N/A | IEA |
| GO:0016740 | GO-mf | transferase activity | EnsemblGenomes | N/A | IEA |
| GO:0016881 | GO-mf | acid-amino acid ligase activity | JGI | N/A | IEA |
| GO:0031625 | GO-mf | ubiquitin protein ligase binding | EnsemblGenomes | N/A | IEA |
| GO:0061630 | GO-mf | ubiquitin protein ligase activity | EnsemblGenomes | N/A | IEA |
| KOG0419 | KOG | Ubiquitin-protein ligase | JGI | N/A | IEA |
| PTHR24067 | Panther | UBIQUITIN-CONJUGATING ENZYME E2 | JGI | N/A | IEA |
| PF00179 | PFAM | Ubiquitin-conjugating enzyme | JGI | N/A | IEA |
|
Glyma.06G190900 not represented in the dataset |
Glyma.06G190900 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.
Gene information in GlycineMine developed by LIS.
Gene families from PhyloGenes.
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma.04g173300 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.06g190900 | Wm82.a4.v1 | ISS | As supplied by JGI |
| Glyma06g20310 | Wm82.a1.v1.1 | IGC | As supplied by JGI |
>Glyma.06g190900.1 sequence-type=CDS polypeptide=Glyma.06g190900.1.p locus=Glyma.06g190900 ID=Glyma.06g190900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 ATGCTGCTGATTTTTGGTCCTGATGATACTCCATGGGATGGAGGCACGTTCAAGTTGACACTCCAATTTACTGAGGACTATCCAAATAAACCACCGACTGTACGATTTGTGTCTCGCATGTTTCATCCAAATATTTATGCTGATGGAAGTATTTGTTTGGATATATTACAAAATCAGTGGAGTCCTATTTATGATGTGGCTGCTATACTCACATCTATCCAGTCATTGCTTTGTGATCCCAACCCAAATTCTCCTGCAAACTCTGAAGCAGCTCGAATGTTTAGTGAGAACAAGCGTGAGTACAATCGAAGAGTGAGGGAAATTGTGGAGCAGAGTTGGACAGCAGATTAA
>Glyma.06g190900.1.p sequence-type=predicted peptide transcript=Glyma.06g190900.1 locus=Glyma.06g190900 ID=Glyma.06g190900.1.Wm82.a2.v1 annot-version=Wm82.a2.v1 MLLIFGPDDTPWDGGTFKLTLQFTEDYPNKPPTVRFVSRMFHPNIYADGSICLDILQNQWSPIYDVAAILTSIQSLLCDPNPNSPANSEAARMFSENKREYNRRVREIVEQSWTAD*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||