Glyma.05g243800

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.05g243800

Feature Type:	gene_model
Chromosome:	Gm05
Start:	41837252
stop:	41839280
Source:	JGI
Version:	Wm82.a2.v1
High confidence:	yes

A previous version of this gene model can be found here:

Annotations for Glyma.05g243800

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G18130.1	AT	receptor for activated C kinase 1C	JGI	N/A	IEA
GO:0005840	GO-cc	ribosome	EnsemblGenomes	N/A	IEA
GO:0005515	GO-mf	protein binding	EnsemblGenomes	N/A	IEA
GO:0005515	GO-mf	protein binding	JGI	N/A	IEA
KOG0279	KOG	G protein beta subunit-like protein	JGI	N/A	IEA
PTHR19868	Panther	RECEPTOR FOR ACTIVATED PROTEIN KINASE C (RACK1)	JGI	N/A	IEA
PF00400	PFAM	WD domain, G-beta repeat	JGI	N/A	IEA

Expression Patterns of Glyma.05g243800

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.

Gene information in GlycineMine developed by LIS.

Related Plant Genes

Gene families from PhyloGenes.

Paralogs of Glyma.05g243800

Paralog	Evidence	Comments
Glyma.08g051600	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.05g243800 Gene Call Version Wm82.a2.v1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma05g34070	Wm82.a1.v1.1	IGC	As supplied by JGI

Coding sequences of Glyma.05g243800

Limit To All Plant Sequences

>Glyma.05g243800.1 sequence-type=CDS polypeptide=Glyma.05g243800.1.p locus=Glyma.05g243800 ID=Glyma.05g243800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCAGAGGGTCTCGTTCTCCGCGGAACCATGCGCGCCCACACCGACGTCGTGACGGCGATTGCCACTCCCATCGACAACTCCGACATGATCGTGACGGCGTCGCGCGACAAATCCATCATTCTCTGGCACCTCACCAAGGAGGACAAGACCTACGGTGTCCCCCGCCGCCGCCTCACCGGACATTCTCACTTCGTCCAGGACGTCGTCCTCTCATCCGACGGTCAGTTCGCCCTCTCCGGCTCCTGGGACGGCGAGCTCCGCCTCTGGGACCTCGCGGCTGGCACCTCTGCCCGCCGCTTCGTTGGCCACACCAAGGACGTGCTCTCCGTGGCGTTCTCCATCGACAACCGTCAGATCGTGTCGGCCTCTCGTGACCGCACGATCAAGCTGTGGAACACCCTGGGTGAGTGCAAGTACACAATCCAAGATGGCGATGCGCATTCGGATTGGGTAAGTTGCGTCCGTTTCAGCCCTAGCACTCTTCAGCCAACCATTGTTTCTGCTTCATGGGACAGGACCGTTAAGGTTTGGAACCTGACCAACTGCAAGCTGAGGAACACCCTTGCTGGACACAATGGGTATGTGAATACTGTTGCTGTTTCCCCTGATGGCTCTCTCTGTGCCAGTGGTGGCAAAGATGGGGTTATTCTTCTGTGGGATTTGGCTGAGGGTAAGCGTCTTTACTCTCTCGATGCTGGCTCAATCATCCATGCACTCTGCTTCAGCCCCAACAGGTACTGGCTCTGCGCCGCCACCGAGCAGAGCATCAAGATCTGGGATTTGGAGAGCAAGAGTATCGTTGAGGATTTGAAGGTTGACCTCAAGACTGAGGCTGATGCCACCTCCGGTGGTGGTAACGCCAACAAGAAGAAGGTTATTTATTGCACAAGTTTGAACTGGAGTGCGGATGGAAGCACTTTGTTTAGTGGCTATACCGATGGTGTGGTCAGAGTTTGGGCTATTGGACGTTATTAG

Predicted protein sequences of Glyma.05g243800

Limit To All Plant Sequences

>Glyma.05g243800.1.p sequence-type=predicted peptide transcript=Glyma.05g243800.1 locus=Glyma.05g243800 ID=Glyma.05g243800.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MAEGLVLRGTMRAHTDVVTAIATPIDNSDMIVTASRDKSIILWHLTKEDKTYGVPRRRLTGHSHFVQDVVLSSDGQFALSGSWDGELRLWDLAAGTSARRFVGHTKDVLSVAFSIDNRQIVSASRDRTIKLWNTLGECKYTIQDGDAHSDWVSCVRFSPSTLQPTIVSASWDRTVKVWNLTNCKLRNTLAGHNGYVNTVAVSPDGSLCASGGKDGVILLWDLAEGKRLYSLDAGSIIHALCFSPNRYWLCAATEQSIKIWDLESKSIVEDLKVDLKTEADATSGGGNANKKKVIYCTSLNWSADGSTLFSGYTDGVVRVWAIGRY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain