SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.05g185600

Feature Type:gene_model
Chromosome:Gm05
Start:37251318
stop:37254427
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.05g185600
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G52860.1AT JGI N/AIEA
GO:0006355GO-bp regulation of transcription, DNA-templated EnsemblGenomesN/AIEA
GO:0016592GO-cc mediator complex EnsemblGenomesN/AIEA

Proteins Associated with Glyma.05g185600
LocusGene SymbolProtein Name
MED28-1 Mediator Complex 28 gene 1

Expression Patterns of Glyma.05g185600
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.05g185600
ParalogEvidenceComments
Glyma.08g143600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.05g185600 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma05g31930 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.05g185600
>Glyma.05g185600.1 sequence-type=CDS polypeptide=Glyma.05g185600.1.p locus=Glyma.05g185600 ID=Glyma.05g185600.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGGTGATCGGCAAGTAGTTGACCAACAACACATGGGTGATCCACAACTGCCATCTTCTCCTCCCTCAAAGGATGATATGGTTTCATGTGTTATGGCTTTGGAGGCTGCTTTGCTTCCCTGTTTGCCAGCCAGAGAACTTCAAGCAATAGACCGTTCTCCCCACCCCTCACATCAAATTGATGTGGATAGGTATGCAAGAGACTTCATGGAGGCTGCCAAGAAGCTTCAGCTTTATTTTATCAGCCTGCAACGTGAGGATAAGCCAACAAAAGTTGAAATGCTTAGAAAGGAGATCGCTCTGATGGAAGAGGAACTTAACATAAAGAATGAGCTGATAAAAAAACAAGAAAATTTAATTCAGGAGTGGAAAAAAGAGTTGAAAGATCAGTTGGACAAACACAAGATTGAGTTGGATAGGGTTTAG
Predicted protein sequences of Glyma.05g185600
>Glyma.05g185600.1.p sequence-type=predicted peptide transcript=Glyma.05g185600.1 locus=Glyma.05g185600 ID=Glyma.05g185600.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MGDRQVVDQQHMGDPQLPSSPPSKDDMVSCVMALEAALLPCLPARELQAIDRSPHPSHQIDVDRYARDFMEAAKKLQLYFISLQREDKPTKVEMLRKEIALMEEELNIKNELIKKQENLIQEWKKELKDQLDKHKIELDRV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo