SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.05g121100

Feature Type:gene_model
Chromosome:Gm05
Start:31400610
stop:31404065
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.05g121100
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G26420.1AT RNA-binding (RRM/RBD/RNP motifs) family protein with retrovirus zinc finger-like domain JGI N/AIEA
GO:0003676GO-mf nucleic acid binding EnsemblGenomesN/AIEA
GO:0003676GO-mf nucleic acid binding JGI N/AIEA
GO:0003723GO-mf RNA binding EnsemblGenomesN/AIEA
GO:0008270GO-mf zinc ion binding EnsemblGenomesN/AIEA
GO:0008270GO-mf zinc ion binding JGI N/AIEA
KOG0114 KOG Predicted RNA-binding protein (RRM superfamily) JGI N/AIEA
PTHR24012Panther FAMILY NOT NAMED JGI N/AIEA
PTHR24012:SF188Panther JGI N/AIEA
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI N/AIEA
PF00098PFAM Zinc knuckle JGI N/AIEA

Expression Patterns of Glyma.05g121100
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.05g121100
ParalogEvidenceComments
Glyma.08g075700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.05g121100 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma05g24960 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.05g121100
>Glyma.05g121100.1 sequence-type=CDS polypeptide=Glyma.05g121100.1.p locus=Glyma.05g121100 ID=Glyma.05g121100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTCTGACGTGGAAGAGTTTCGTTGCTTCATTGGTGGCCTTGCATGGTCAACGTCTGATAGAAAGTTAAAGGATACATTTGAAAAGTTTGGCAAGCTTATTGAGGCAAAGGTGGTTGTTGACAAGTTCTCTGGGCGTTCTCGTGGTTTTGGATTTGTCACATTTGATGACAAGAAAGCAATGGACGAGGCTATTGATGCTATGAATGGGATAGATTTAGACGGGCGAACTATTACTGTTGATAGAGCTCAGCCTCAACAAGGATCAACTAGAGATGATGGTGATCGTTACCGGGAGCGTGGTCGTGATCGTGATCGTAACCGAGATTATGGAGGTGGAGGTGGTCGAGGATCTAATGGTGGTGAATGCTTTAAGTGTGGAAAACCTGGTCATTTTGCTAGGGAATGCCCTGGTGAAGGGTCCAGGGGAGGAAGGTATGGTGGTAGGGAAAGTAGATATGGTGGAAGCAGTGGTGGTGGTTATGGACCGGATAGAAATGCAGATCGTTCTTCAGGGGGGCGCAGCAGGGATGGTGGTAGTCATGGGGATTCTGGAAGTGATCGATATTATCGTGATCGTTCAGGACCATATGAGCGGGAGCGACGGGGATCGGGAGGCTTTCGTTGA
Predicted protein sequences of Glyma.05g121100
>Glyma.05g121100.1.p sequence-type=predicted peptide transcript=Glyma.05g121100.1 locus=Glyma.05g121100 ID=Glyma.05g121100.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MSDVEEFRCFIGGLAWSTSDRKLKDTFEKFGKLIEAKVVVDKFSGRSRGFGFVTFDDKKAMDEAIDAMNGIDLDGRTITVDRAQPQQGSTRDDGDRYRERGRDRDRNRDYGGGGGRGSNGGECFKCGKPGHFARECPGEGSRGGRYGGRESRYGGSSGGGYGPDRNADRSSGGRSRDGGSHGDSGSDRYYRDRSGPYERERRGSGGFR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo