SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.05G157300

Feature Type:gene_model
Chromosome:Gm05
Start:34976428
stop:34978794
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.05G157300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G19780.1AT tubulin alpha-5 JGI N/AIEA
GO:0006184GO-bp GTP catabolic process JGI N/AIEA
GO:0007010GO-bp cytoskeleton organization EnsemblGenomesN/AIEA
GO:0007017GO-bp microtubule-based process EnsemblGenomesN/AIEA
GO:0051258GO-bp protein polymerization JGI N/AIEA
GO:0005874GO-cc microtubule EnsemblGenomesN/AIEA
GO:0000166GO-mf nucleotide binding EnsemblGenomesN/AIEA
GO:0003924GO-mf GTPase activity EnsemblGenomesN/AIEA
GO:0003924GO-mf GTPase activity JGI N/AIEA
GO:0005200GO-mf structural constituent of cytoskeleton EnsemblGenomesN/AIEA
GO:0005525GO-mf GTP binding EnsemblGenomesN/AIEA
GO:0005525GO-mf GTP binding JGI N/AIEA
KOG1376 KOG Alpha tubulin JGI N/AIEA
PTHR11588Panther TUBULIN JGI N/AIEA
PF00091PFAM Tubulin/FtsZ family, GTPase domain JGI N/AIEA
PF03953PFAM Tubulin C-terminal domain JGI N/AIEA

Proteins Associated with Glyma.05G157300
LocusGene SymbolProtein Name
Tubulin tubulin
TFL1 transcriptional repressor

Expression Patterns of Glyma.05G157300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.05G157300
ParalogEvidenceComments
Glyma.08g115100 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.05G157300 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g157300 Wm82.a4.v1ISS As supplied by JGI
Glyma05g29000 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.05G157300
>Glyma.05g157300.1 sequence-type=CDS polypeptide=Glyma.05g157300.1.p locus=Glyma.05g157300 ID=Glyma.05g157300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGAGAGAAATCATCAGCATTCACATAGGTCAGGCCGGGATCCAGGTCGGAAACTCCTGCTGGGAACTCTACTGCCTCGAACATGGCATCCAGCCCGACGGCATGATGCCTTCTGACTCCACCTTCGGTGTAGCCCACGACGCCTTCAACACCTTCTTCAGCGAAACCGGATCTGGCAAGCACGTCCCCCGTGCTGTCTTCGTCGACCTCGAACCCACCGTCATCGACGAGGTCCGCTGCGGCACCTACCGTCAACTCTTCCACCCCGAACAACTCATCTCCGGCAAGGAAGACGCCGCCAACAACTTCGCCCGCGGCCACTACACCGTTGGCAAAGAGATCGTAGATCTGTGCTTGGATCGCGTCCGCAAGCTCGCCGACAACTGCACCGGCCTACAAGGCTTCCTCGTCTTCAACGCCGTCGGCGGTGGCACCGGTTCCGGTCTCGGATCTCTCTTACTCGAGCGTCTCTCCGTCGATTACGGCAAAAAATCCAAATTAGGGTTCACCATTTACCCTTCCCCACAGGTTTCAACCGCAGTCGTTGAACCCTACAACAGCGTCCTCTCCACCCACTCCCTCCTGGAACACACCGACGTGGCGGTCCTCTTGGACAACGAAGCCATCTACGACATCTGCAGGAGATCCCTCGACATCGAGAGACCAACCTACACCAACCTCAACAGGCTCATTTCCCAGATCATTTCGTCCCTCACCACTTCCTTGAGGTTCGATGGTGCCATCAATGTGGATATCACTGAGTTCCAGACCAACCTTGTGCCCTACCCTAGGATCCACTTCATGCTTTCGTCCTATGCTCCGGTTATCTCTGCCGCCAAGGCCTACCACGAGCAGTTGTCGGTGCCGGAGATCACCAATGCCGTGTTCGAGCCCGCCAGCATGATGGCCAAGTGTGATCCAAGGCACGGCAAGTACATGGCTTGCTGCTTGATGTACCGTGGTGATGTTGTCCCTAAGGATGTCAATGCTGCTGTTGCCACCATCAAGACTAAGAGGACTGTTCAGTTTGTTGATTGGTGTCCAACTGGATTCAAGTGTGGTATCAACTACCAGCCACCTTCTGTTGTTCCTGGTGGTGACCTTGCTAAGGTTCAGCGTGCTGTATGCATGATCAGCAACAACACCGCAGTTGCTGAGGTGTTCTCTCGCATTGACCACAAGTTTGATCTGATGTATGCCAAGAGGGCTTTTGTTCACTGGTATGTTGGTGAGGGTATGGAAGAAGGGGAGTTTTCTGAGGCTCGTGAGGACCTTGCTGCTCTTGAGAAGGACTATGAGGAGGTTGGAGCTGAAGGAGCGGAAGATGATGAGGAAGGAGAGGACTATTGA
Predicted protein sequences of Glyma.05G157300
>Glyma.05g157300.1.p sequence-type=predicted peptide transcript=Glyma.05g157300.1 locus=Glyma.05g157300 ID=Glyma.05g157300.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MREIISIHIGQAGIQVGNSCWELYCLEHGIQPDGMMPSDSTFGVAHDAFNTFFSETGSGKHVPRAVFVDLEPTVIDEVRCGTYRQLFHPEQLISGKEDAANNFARGHYTVGKEIVDLCLDRVRKLADNCTGLQGFLVFNAVGGGTGSGLGSLLLERLSVDYGKKSKLGFTIYPSPQVSTAVVEPYNSVLSTHSLLEHTDVAVLLDNEAIYDICRRSLDIERPTYTNLNRLISQIISSLTTSLRFDGAINVDITEFQTNLVPYPRIHFMLSSYAPVISAAKAYHEQLSVPEITNAVFEPASMMAKCDPRHGKYMACCLMYRGDVVPKDVNAAVATIKTKRTVQFVDWCPTGFKCGINYQPPSVVPGGDLAKVQRAVCMISNNTAVAEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEEVGAEGAEDDEEGEDY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo