SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.04g181400

Feature Type:gene_model
Chromosome:Gm04
Start:44740548
stop:44745577
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.04g181400
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G58610.1AT ketol-acid reductoisomerase JGI N/AIEA
GO:0008652GO-bp cellular amino acid biosynthetic process EnsemblGenomesN/AIEA
GO:0009082GO-bp branched-chain amino acid biosynthetic process EnsemblGenomesN/AIEA
GO:0009082GO-bp branched-chain amino acid biosynthetic process JGI N/AIEA
GO:0009097GO-bp isoleucine biosynthetic process EnsemblGenomesN/AIEA
GO:0009099GO-bp valine biosynthetic process EnsemblGenomesN/AIEA
GO:0055114GO-bp oxidation-reduction process EnsemblGenomesN/AIEA
GO:0055114GO-bp oxidation-reduction process JGI N/AIEA
GO:0004455GO-mf ketol-acid reductoisomerase activity EnsemblGenomesN/AIEA
GO:0004455GO-mf ketol-acid reductoisomerase activity JGI N/AIEA
GO:0016491GO-mf oxidoreductase activity EnsemblGenomesN/AIEA
PTHR21371Panther FAMILY NOT NAMED JGI N/AIEA
PTHR21371:SF4Panther JGI N/AIEA
PF01450PFAM Acetohydroxy acid isomeroreductase, catalytic domain JGI N/AIEA
BRANCHED-CHAIN-AA-SYN-PWYSoyCyc9 superpathway of branched chain amino acid biosynthesis Plant Metabolic Network ISS
VALSYN-PWYSoyCyc9 L-valine biosynthesis Plant Metabolic Network ISS
GN7V-61743SoyCyc9-rxn ketol-acid reductoisomerase Plant Metabolic Network ISS

Expression Patterns of Glyma.04g181400
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma.04g181400 not represented in the dataset
Glyma.04g181400 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Gene model name correspondences to Glyma.04g181400 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma04g35256 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.04g181400
>Glyma.04g181400.1 sequence-type=CDS polypeptide=Glyma.04g181400.1.p locus=Glyma.04g181400 ID=Glyma.04g181400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGAATACAGGAGTCACATCTTTCGGGAGAGAGGCATTTTACTTAGGGCTGTTCATGGTATTGTGGAATCCTTGTTTAGGAGGTACACTGAAAATGGAATGAGTGAAGATTTGGCCTATAACAACACTGTCGAGCCCATTACAAGAACTATATCTAAAATAATCTCGACTAAGGGTATGGAATTTGAGAAAGCATATAGTGCTTCATATTATTCCTGCATGGACATTTTGTATGCGTGCTATGAGGATATTGCTGCTAGAAGTGACATTCGCAGTGTTGTCTTGGATGGGCGGAACTTTTATGTATGTACGTTGCTTGCATTTCCCATGGGTAAAATTGATCAGACCCTGATGTGGAAGGTTGGTTAG
Predicted protein sequences of Glyma.04g181400
>Glyma.04g181400.1.p sequence-type=predicted peptide transcript=Glyma.04g181400.1 locus=Glyma.04g181400 ID=Glyma.04g181400.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MEYRSHIFRERGILLRAVHGIVESLFRRYTENGMSEDLAYNNTVEPITRTISKIISTKGMEFEKAYSASYYSCMDILYACYEDIAARSDIRSVVLDGRNFYVCTLLAFPMGKIDQTLMWKVG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo